Shop All DNA Primers & Oligos

T7 promoter Sequencing Primer, 20-mer (Thermo Scientific™)

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments located downstream from the T7 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO118—T7 promoter sequencing primer, 20-mer 5'-d (TAATACGACTCACTATAGGG)-3'
Note
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
T3 promoter Sequencing Primer, 17-mer
SP6 promoter Sequencing Primer, 24-mer
T3 promoter Sequencing Primer, 24-mer
SP6 promoter Sequencing Primer, 18-mer

VetMAX™ AIV Reagents (Applied Biosystems™)

Note: The name of this product has changed. It was previously called TAQMAN AIV REAGENTS EACH.

TaqMan® AIV-Matrix Reagents enable one-step, real-time, RT-PCR amplification of Avian Influenza Virus matrix gene RNA and Xeno™ RNA Internal Positive Control.

For Research Use Only. Not for use in diagnostics procedures.

T3 promoter Sequencing Primer, 17-mer (Thermo Scientific™)

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T3 RNA Polymearse promoter region and are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments located downstream from the T3 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO119—T3 promoter sequencing primer, 17-mer 5'-d (ATTAACCCTCACTAAAG)-3'
• SO120—T3 promoter sequencing primer, 24-mer 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3'

Note
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
T3 promoter Sequencing Primer, 24-mer
T7 promoter Sequencing Primer, 20-mer
SP6 promoter Sequencing Primer, 18-mer
SP6 promoter Sequencing Primer, 24-mer

Custom TaqMan™ Copy Number Assay (Applied Biosystems™)

Applied Biosystems TaqMan Copy Number Assays use gold-standard TaqMan MGB probe chemistry to evaluate the copy number of genomic DNA targets using Applied Biosystems real-time PCR instruments and software. TaqMan Copy Number Assays are run together with a TaqMan Copy Number Reference Assay in a duplex qPCR reaction; the copy number assay detects the target sequence, and the reference assay detects a sequence that is known to be present in two copies in the diploid genome. The results are then analyzed by the relative quantitation method using Applied Biosystems CopyCaller Software.

Custom TaqMan Copy Number Assays are an option for targets of interest that are not covered by the predesigned assay collection. The GeneAssist Copy Number Assay Tool enables you to submit your own premasked custom target sequences for assay design or primer/probe pair sequences for assay formulation, at no extra charge. The design process for Custom TaqMan Copy Number Assays does not include up-front bioinformatic sequence analysis or in silico QC, but the designs can be compared with the human/mouse reference assays for compatibility in duplex reactions.

Benefits:
Flexible—generate assays for any target of interest using the GeneAssist Copy Number Assay Tool, with no species limitations
Specific—gold standard TaqMan chemistry with minor groove binder (MGB) probes increase assay specificity by enabling shorter probes
Reproducible—robust assay designs developed with our optimized algorithms deliver accurate, reproducible, and reliable results
Easy to interpret—CopyCaller Software provides the calculated copy number and predicted copy number, along with confidence value and z-score quality metrics
Fast and simple—setup to primary analysis in 3–4 hours

Approximate delivery time
4–6 days in North America and 6–10 days in Europe

TaqMan Assays have been cited in over 40,000 publications and are backed by more than 350 patents.

TaqMan Copy Number Reference Assays are sold separately.

Recommended master mix (sold separately): TaqMan Genotyping Master Mix

Random Hexamers (50 µM) (Invitrogen™)

Invitrogen® Random Hexamers are short oligodeoxyribonucleotides of random sequence [d(N)6] that anneal to random complementary sites on a target DNA or RNA, to serve as primers for DNA synthesis by a DNA polymerase or reverse transcriptase. Five nmoles of primer is supplied at a concentration of 50 µM.

T3 promoter Sequencing Primer, 24-mer (Thermo Scientific™)

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T3 RNA Polymearse promoter region and are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments located downstream from the T3 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO119—T3 promoter sequencing primer, 17-mer 5'-d (ATTAACCCTCACTAAAG)-3'
• SO120—T3 promoter sequencing primer, 24-mer 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3'

Note
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
SP6 promoter Sequencing Primer, 18-mer
T3 promoter Sequencing Primer, 17-mer
SP6 promoter Sequencing Primer, 24-mer
T7 promoter Sequencing Primer, 20-mer

TaqMan™ RNase P Assay, VIC™ dye/QSY™ probe (Applied Biosystems™)

The Applied Biosystems™ TaqMan™ RNase P Assay with VIC™ dye-labeled QSY™ probe provides a pre-formulated assay for quantitating human RNase P. This assay enables relative gene expression quantification in cDNA samples when used with other gene expression assays. It consists of a VIC dye-labeled QSY probe plus sequence-specific forward and reverse primers. The assay can be used for multiplex or singleplex PCR reactions. For an assay with ABY™ dye-labeled probe rather than VIC dye-labeled probe, see Cat. No. 4485714.

Benefits of this assay include:

• Eliminate assay design time using pre-designed primers and pre-designed VIC dye-labeled TaqMan probe
• Minimize experimental optimization time
• Use in conjunction with FAM™ dye-labeled predesigned gene expression assays

Save time in assay design, formulation, and testing by using the TaqMan RNase P Assay as your control when quantifying gene expression. This pre-designed probe and primer set enables you to normalize the amount of sample RNA or DNA in a reaction when used with a control sample. Or use it for relative gene expression quantification in cDNA samples when used with other gene expression assays.

The VIC dye is optimized for use with the second filter of our QuantStudio™, ViiA™ 7, and 7500 series real-time PCR instruments.

TaqMan™ Gene Expression Assay, VIC primer-limited (Applied Biosystems™)

Applied Biosystems TaqMan Gene Expression Assays, VIC primer-limited, are used for quantitative real-time PCR analysis of gene expression and consist of a pair of unlabeled PCR primers and a TaqMan probe with a dye label (VIC) on the 5’ end and a minor groove binder (MGB) and nonfluorescent quencher (NFQ) on the 3’ end. These assays are primer-limited and ideal for multiplex reactions looking at two different gene targets in the same qPCR well.

Features include:
Easy to use—just add cDNA and master mix and run the qPCR—no melt curves required
Specific—TaqMan assays use proprietary MGB-containing probes that can be up to 15 bases shorter than non-MGB probes, improving the specificity of the assay
Sensitive—TaqMan assays are ideal for measuring low levels of expression or low-abundance targets
Accurate—identify small fold-changes with high accuracy of quantitation
Extensive content—over 1.8 million predesigned assays available for over 25 different species
Gold-standard TaqMan qPCR chemistry—TaqMan assays draw on Thermo Fisher Scientific's bioinformatics assay design pipeline to help ensure high specificity and minimal cross-reactivity, even for gene variants with high sequence homology
Ideal for multiplexing—combine one FAM-labeled and one VIC-labeled assay to create a duplex assay for two different gene targets in the same qPCR well
Ideal for control assays—use a VIC primer-limited assay for high-expressing endogenous control genes

Approximate ship time
Made to order: 4–6 days in North America, 6–10 days in Europe

TaqMan Gene Expression assays are the gold standard in real-time PCR gene expression studies, built on more than 20 years of experience. Each assay includes target primers and a sequence-specific probe optimized for the best functional performance. No additional design, optimization, or melt curve analysis is needed. Available in a wide variety of formats and species, new assay designs are constantly added to help meet your research needs. TaqMan assays have been cited in over 40,000 publications and are backed by more than 350 patents. All of our predesigned TaqMan Gene Expression assays are covered by the TaqMan Assays qPCR Guarantee.*

Recommended master mix: TaqMan Fast Advanced Master Mix

*Subject to terms and conditions. For complete details, go to www.thermofisher.com/taqmanguarantee.

Sequence Detection Primer (Applied Biosystems™)

Sequence detection primers are unlabeled primers that can be used with TaqMan probes or SYBR Green dye for your real-time PCR research applications.

Features include:
• Choice of delivered scales
• For use in any real-time PCR or PCR application
• All sequence detection primers are desalted

Real-time PCR sequence detection primers are delivered in either dry or liquid format.

Guaranteed yield
The unit size you select is based on the minimum amount we will deliver, not on synthesis starting amount.

Approximate ship time
4–6 days in North America, 5-10 days in Europe

We also offer:
• Custom TaqMan probes with a variety of options for dyes and quenchers. Learn more ›
• TaqMan MGB probes and primers available as predesigned and pre-formulated TaqMan Assays. Learn more ›
• Commercial manufacturing products and services, including OEM and GMP oligo manufacturing. Learn more ›

Need a different dye or concentration or a larger lot size? The TaqMan Custom Assay and Oligo Service offers custom products that you can tailor to meet your experimental needs. Learn more ›

Oligo d(T)16 (50 µM) (Invitrogen™)

Invitrogen® Oligo d(T)16 is a homo-oligomeric deoxyribonucleotide (poly dT) that is non-phosphorylated and chemically synthesized. It is used for priming and reverse transcription of polyadenylated (poly A+) mRNA. Five nmoles of primer is supplied at a concentration of 50 µM.

Oligo(dT)18 Primer (Thermo Scientific™)

Thermo Scientific Oligo(dT)18 Primer is a synthetic single-stranded 18-mer oligonucleotide with 5'- and 3'-hydroxyl ends. The primer is supplied as a ready-to-use, 20X concentrated aqueous solution.

Applications

• cDNA Synthesis
• RT-qPCR
• RT-PCR

Related Products
Anchored Oligo dT
Random Hexamer Primer
Oligo(dT)18 Primer

TaqMan™ RNase P Assay, VIC™ dye/QSY™ probe, primer-limited (Applied Biosystems™)

The Applied Biosystems™ TaqMan™ RNase P Assay with VIC™ dye-labeled QSY™ probe provides a pre-formulated assay for quantitating human RNase P. This assay enables relative gene expression quantification in cDNA samples when used with other gene expression assays. It consists of a VIC dye-labeled QSY probe plus sequence-specific forward and reverse primers. The assay can be used for multiplex or singleplex PCR reactions and it is primer limited, so it can be used with samples that overexpress RNase P. For a primer-limited assay with ABY™ dye-labeled probe rather than VIC dye-labeled probe, see Cat. No. 4485715.

Benefits of this assay include:

• Eliminate assay design time using pre-designed primers and pre-designed VIC dye-labeled TaqMan probe
• Minimize experimental optimization time
• Use in conjunction with FAM™ dye-labeled predesigned gene expression assays
• Formulated at a primer-limited concentration for use in multiplex reactions

Save time in assay design, formulation, and testing by using the TaqMan RNase P Assay as your control when quantifying gene expression. This pre-designed probe and primer set enables you to normalize the amount of sample RNA or DNA in a reaction when used with a control sample. Or use it for relative gene expression quantification in cDNA samples when used with other gene expression assays.

In order to facilitate multiplex experiments, the assay formulation is primer limited, allowing the assay to be used with high RNase P expressors.

The VIC dye is optimized for use with the second filter of our QuantStudio™, ViiA™ 7, and 7500 series real-time PCR instruments.

Custom TaqMan™ Gene Expression Assay, VIC (Applied Biosystems™)

Applied Biosystems Custom TaqMan Gene Expression assays, VIC, are the custom version of our predesigned TaqMan assays for quantitative real-time PCR. Custom TaqMan Gene Expression assays consist of a pair of unlabeled PCR primers and a TaqMan probe with a dye label (VIC) on the 5’ end and a minor groove binder (MGB) and nonfluorescent quencher (NFQ) on the 3’ end.

Features include:
Easy to use—just add cDNA and master mix and run the qPCR—no melt curves required
Specific—TaqMan assays use proprietary MGB-containing probes that can be up to 15 bases shorter than non-MGB probes, improving the specificity of the assay
Sensitive—TaqMan assays are ideal for measuring low levels of expression or low-abundance targets
Accurate—identify small fold-changes with high accuracy of quantitation
Gold-standard TaqMan qPCR chemistry—TaqMan assays draw on Thermo Fisher Scientific's bioinformatics assay design pipeline to help ensure high specificity and minimal cross-reactivity, even for gene variants with high sequence homology
Ideal for multiplexing—combine one FAM-labeled and one VIC-labeled assay to create a duplex assay for two different gene targets in the same qPCR well
Sequences provided—with every Custom TaqMan Gene Expression you design and order

Approximate ship time
Made to order: 4–6 days in North America, 6–10 days in Europe

TaqMan Gene Expression assays are the gold standard in real-time PCR gene expression studies, built on more than 20 years of experience. Each assay includes target primers and a sequence-specific probe optimized for the best functional performance. No additional design, optimization, or melt curve analysis is needed. Available in a wide variety of formats and species, new assay designs are constantly added to help meet your research needs. TaqMan assays have been cited in over 40,000 publications and are backed by more than 350 patents.

Recommended master mix: TaqMan Fast Advanced Master Mix

See also: Custom Plus TaqMan RNA Assays, designed using the full bioinformatic power of the TaqMan Assay design pipeline.

M13/pUC sequencing primer (-20), 17-mer (Thermo Scientific™)

Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

TaqMan™ QSY Probe (Applied Biosystems™)

Applied Biosystems TaqMan QSY probes are dual-labeled probes used for real-time PCR. TaqMan QSY Probes are designed for optimal sensitivity and performance in multiplex qPCR experiments. Current users of dark quencher probes, such as Black Hole Quencher (BHQ™) probes, can design custom QSY probes without changing probe sequences.

All TaqMan QSY probes are HPLC-purified and verified by mass spectrometry to help ensure lot-to-lot reproducibility between batches. Thermo Fisher Scientific has been a leader in qPCR probe manufacturing for over 20 years, with expertise in probe synthesis in a facility that is certified to ISO 13485.

Features of TaqMan QSY probes include:
Sensitivity—lower background and increased signal result in better sensitivity
Multiplexing performance without compromise—successfully multiplex multiple gene targets in a single reaction
Dye options ideal for Applied Biosystems qPCR instrument filters—TaqMan qPCR dyes are designed for optimal alignment with Applied Biosystems qPCR instruments, enabling improved fluorescence signal, especially for low-expressing gene targets
Flexibility—mix and match your multiplex qPCR probes with up to two MGB probes or four QSY probes in a single reaction
Get started quickly—BHQ probe sequences can be converted to QSY versions with no redesign needed
Performance without compromise
Multiplexing with TaqMan QSY probes enables cost savings and preservation of limited samples, and has been shown to yield comparable results between reactions performed in individual tubes and in 4-plex reactions for gene quantification.

Learn more about multiplex real-time PCR ›

Guaranteed yield
The unit size you select is based on the minimum amount we will deliver, not on synthesis starting amount.

Approximate ship time
4–6 days in North America, 5-10 days in Europe

We also offer Applied Biosystems custom primers and other types of TaqMan probes. Learn more ›

Need a different dye or concentration or a larger lot size? The TaqMan Custom Assay and Oligo Service offers custom products that you can tailor to meet your experimental needs. Learn more ›