Shop All DNA Primers & Oligos

Megaplex™ Primer Pools, Human Pools B v3.0 (Applied Biosystems™)

Megaplex™ Primer Pools, Human Pools B v3.0 is available under a single part number containing both the Megaplex™ RT Primers and Megaplex™ PreAmp Primers, Human Pools B v3.0. Megaplex™ RT Primers, Human Pool B v3.0 contains RT primers for 377 unique microRNAs and 4 controls. For use when assay sensitivity of the utmost importance, Megaplex™ PreAmp Primers significantly enhance the ability to detect low expressed microRNAs enabling the generation of a comprehensive expression profile using far less sample, as low as 1 ng of input total RNA. The microRNA targets represented in this pool tend be less well characterized, more narrowly expressed and⁄or expressed at a lower level compared to Human Pool A. Megaplex™ Primer Pools, Human Pools B v3.0 are intended for use with the TaqMan® Array Human MicroRNA B Card v3.0, however, they can also be used to prepare cDNA for real-time analysis using the individual TaqMan® MicroRNA Assays.

Megaplex™ Primer Pools, Human Pools Set v3.0 (Applied Biosystems™)

Megaplex™ Primer Pools, Human Pools Set v3.0 is available under a single part number containing Megaplex™ RT Primers Human Pool A v2.1, Megaplex™ RT Primers Human Pool B v3.0, Megaplex™ PreAmp Primers, Human Pool A v2.1 and Megaplex™ PreAmp Primers, Human Pool B v3.0. Megaplex™ Primer Pools, Human Pools Set v3.0 contains RT primers for 754 unique microRNAs plus 4 controls. For use when assay sensitivity is of the utmost importance, Megaplex™ PreAmp Primers significantly enhance the ability to detect low expressed microRNAs enabling the generation of a comprehensive expression profile using far less sample, as low as 1 ng of input total RNA. The Megaplex™ Primer Pools, Human Pools Set v3.0 is intended for use with the TaqMan® Array Human MicroRNA Card Set v3.0, however, it can also be used to prepare cDNA for real-time analysis using the individual TaqMan® MicroRNA Assays.

M13/pUC Sequencing Primer (-46), 22-mer (Thermo Scientific™)

Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

Megaplex™ Primer Pools, Rodent Pools B v3.0 (Applied Biosystems™)

Megaplex™ Primer Pools, Rodent Pool B v3.0 is available under a single part number containing both the Megaplex™ RT Primers and Megaplex™ PreAmp Primers, Rodent Pools B v3.0. Megaplex™ RT Primers, Rodent Pool B contains RT primers for 306 and 135 unique microRNAs for mouse and rat respectively plus 4 species specific controls. For use when assay sensitivity is of the utmost importance, Megaplex™ PreAmp Primers significantly enhance the ability to detect low expressed microRNAs enabling the generation of a comprehensive expression profile using far less sample, as low as 1 ng of input total RNA. The microRNA targets represented in this pool tend be less well characterized, more narrowly expressed and⁄or expressed at a lower level compared to Rodent Pool A. Rodent Pool B is intended for use with the TaqMan Rodent MicroRNA B Array v3.0, however, it can also be used to prepare cDNA for real-time analysis using the individual TaqMan® MicroRNA Assays.

T7-Oligo(dT)24V Promoter Primer, Anchored (100 ng/μl) (Invitrogen™)

For use in reverse transcription reactions to append a T7 RNA polymerase promoter to cDNA fragments. Each Ambion® primer is PAGE purified and performance tested in reverse transcription and subsequent in vitro transcription reactions. Promoter primers are anchored with a G, A, or C (V).

TaqMan™ TAMRA Probe (Applied Biosystems™)

Applied Biosystems TaqMan TAMRA probes are dual-labeled probes used for real-time PCR applications using TaqMan chemistry. TaqMan TAMRA Probes feature a 5’ fluorescent reporter dye (FAM, VIC, or TET) and 3’ fluorescent quencher (TAMRA dye). TaqMan TAMRA probes, which were some of the first TaqMan probes to be developed, can be used for a variety of applications.

TAMRA is a fluorescent dye and can be multiplexed with up to three dyes. (If multiplexing higher than triplex, TaqMan QSY probes are recommended.) TAMRA probes are typically longer (30 to >40 bases). For enhanced specificity, shorter TaqMan MGB nonfluorescent quencher (NFQ) probes (generally 15 to 20 bases) are also available.

All TaqMan TAMRA probes are HPLC-purified and verified by mass spectrometry to help ensure lot-to-lot reproducibility between batches. Thermo Fisher Scientific has been a leader in qPCR probe manufacturing for over 20 years. TaqMan Probes are manufactured in a facility that is certified to ISO 13485.

Guaranteed yield
The unit size you select is based on the minimum amount we will deliver, not on synthesis starting amount.

Approximate ship time
4–6 days in North America, 5-10 days in Europe

We also offer Applied Biosystems custom primers and other types of TaqMan probes. Learn more ›

Need a different dye or concentration or a larger lot size? The TaqMan Custom Assay and Oligo Service offers custom products that you can tailor to meet your experimental needs. Learn more ›

M13/pUC Reverse Sequencing Primer (-46), 24-mer (Thermo Scientific™)

Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

Megaplex™ Primer Pools, Rodent Pools Set v3.0 (Applied Biosystems™)

Megaplex™ Primer Pools, Rodent Pools Set v3.0 is available under a single part number containing both the Megaplex™ RT Primers and Megaplex™ PreAmp Primers, Rodent Pools Sets. Megaplex™ RT Primers, Rodent Pools Set collectively contains RT primers for 641 and 373 unique microRNAs for mouse and rat respectively plus 4 species specific controls. For use when assay sensitivity is of the utmost importance, Megaplex™ PreAmp Primers significantly enhance the ability to detect low expressed microRNAs enabling the generation of a comprehensive expression profile using far less sample, as low as 1 ng of input total RNA. The Megaplex™ Primer Pools, Rodent Pools Set is intended for use with the TaqMan® Rodent MicroRNA Array Set v3.0, however, it can also be used to prepare cDNA for real-time analysis using the individual TaqMan® MicroRNA Assays.

M13 Forward (-20) (Invitrogen™)

Oligonucleotides complementary to a DNA template are necessary to prime DNA synthesis for sequencing reactions. Invitrogen offers a wide selection of single-strand primers that may be used in either single- or double-stranded sequencing protocols. All sequencing primers are non-phosphorylated and are supplied lyophilized.

All primers are:

Desalted and purified by gel filtration
• Assayed for function in automated sequencing reactions
• Supplied in quantity of 2 µg

Random Decamers (50 µM) (Invitrogen™)

Random Decamers are the same primers currently included in the RETROscript® Kit (Cat. No. AM1710). They are provided at a stock concentration of 50 µM, and are functionally tested using the RETROscript® Kit.

Using random primers
Generally, reverse transcription reactions are primed with one of the following types of primers: random sequence oligonucleotides, oligo(dT), or an oligonucleotide that can hybridize with the specific RNA under study. The type of first-strand primer used for reverse transcription is mostly based on user preference. For cDNA library construction or cDNA labeling applications, oligo(dT) is almost always used to prime cDNA synthesis, so that the cDNA will start at the poly(A) tail. The greatest yield of RT product is usually obtained by using short random oligonucleotides to prime the reverse transcription, but this yield advantage may not be seen after the PCR step. When template is limiting, final RT-PCR yield may be somewhat higher when the reverse transcription is primed with random primers as opposed to oligo(dT) or gene-specific primers.

Custom TaqMan™ Gene Expression Assay, VIC primer-limited (Applied Biosystems™)

Applied Biosystems Custom TaqMan Gene Expression assays, VIC primer-limited, are the custom version of our predesigned TaqMan assays for quantitative real-time PCR. Custom TaqMan Gene Expression assays consist of a pair of unlabeled PCR primers and a TaqMan probe with a dye label (VIC) on the 5’ end and a minor groove binder (MGB) and nonfluorescent quencher (NFQ) on the 3’ end.

Features include:
Easy to use—just add cDNA and master mix and run the qPCR—no melt curves required
Specific—TaqMan assays use proprietary MGB-containing probes that can be up to 15 bases shorter than non-MGB probes, improving the specificity of the assay
Sensitive—TaqMan assays are ideal for measuring low levels of expression or low-abundance targets
Accurate—identify small fold-changes with high accuracy of quantitation
Gold-standard TaqMan qPCR chemistry—TaqMan assays draw on Thermo Fisher Scientific's bioinformatics assay design pipeline to help ensure high specificity and minimal cross-reactivity, even for gene variants with high sequence homology
Ideal for multiplexing—combine one FAM-labeled and one VIC-labeled assay to create a duplex assay for two different gene targets in the same qPCR well
Ideal for control assays—use a VIC primer-limited assay for high-expressing endogenous control genes
Sequences provided—with every Custom TaqMan Gene Expression you design and order

Approximate ship time
Made to order: 4–6 days in North America, 6–10 days in Europe

TaqMan Gene Expression assays are the gold standard in real-time PCR gene expression studies, built on more than 20 years of experience. Each assay includes target primers and a sequence-specific probe optimized for the best functional performance. No additional design, optimization, or melt curve analysis is needed. Available in a wide variety of formats and species, new assay designs are constantly added to help meet your research needs. TaqMan assays have been cited in over 40,000 publications and are backed by more than 350 patents.

Recommended master mix: TaqMan Fast Advanced Master Mix

See also: Custom Plus TaqMan RNA Assays, designed using the full bioinformatic power of the TaqMan Assay design pipeline.

SP6 promoter Sequencing Primer, 18-mer (Thermo Scientific™)

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the SP6 RNA Polymerase promoter region and are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO116—SP6 promoter sequencing primer, 18-mer 5'-d (ATTTAGGTGACACTATAG)-3'
• SO117—SP6 promoter sequencing primer, 24-mer 5'-d (CATACGATTTAGGTGACACTATAG)-3'
Note
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
SP6 promoter Sequencing Primer, 24-mer
T7 promoter Sequencing Primer, 20-mer
T3 promoter Sequencing Primer, 17-mer
T3 promoter Sequencing Primer, 24-mer

M13 Reverse (Invitrogen™)

Oligonucleotides complementary to a DNA template are necessary to prime DNA synthesis for sequencing reactions. Invitrogen offers a wide selection of single-strand primers that may be used in either single- or double-stranded sequencing protocols. All sequencing primers are non-phosphorylated and are supplied lyophilized.

All primers are:

Desalted and purified by gel filtration
• Assayed for function in automated sequencing reactions
• Supplied in quantity of 2 µg

Oligo (dT) Primer (50 µM) (Invitrogen™)

These are the same Ambion® primers that are currently included in the RETROscript® Kit (SKU# AM1710). They are provided at a stock concentration of 50 µM and are functionally tested using the RETROscript® Kit.

SP6 promoter Sequencing Primer, 24-mer (Thermo Scientific™)

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the SP6 RNA Polymerase promoter region and are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO116—SP6 promoter sequencing primer, 18-mer 5'-d (ATTTAGGTGACACTATAG)-3'
• SO117—SP6 promoter sequencing primer, 24-mer 5'-d (CATACGATTTAGGTGACACTATAG)-3'
Note
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
SP6 promoter Sequencing Primer, 18-mer
T7 promoter Sequencing Primer, 20-mer
T3 promoter Sequencing Primer, 17-mer
T3 promoter Sequencing Primer, 24-mer