Shop All DNA Primers & Oligos

Megaplex™ RT Primers, Rodent Pool A (Applied Biosystems™)

Designed to streamline experimental workflows, Applied Biosystems® Megaplex™ RT Primers provide a single reaction solution when preparing cDNA for real-time PCR analysis on a TaqMan® MicroRNA Array. Rodent Pool A contains RT primers for 335 and 238 unique microRNAs for mouse and rat respectively plus 4 species specific controls. The microRNA targets represented in this pool tend be better characterized, more broadly expressed and⁄or expressed at a higher level compared to Human Pool A. The pool can also be used to prepare cDNA for real-time analysis using the individual TaqMan® MicroRNA Assays.

TaqMan™ Gene Expression Assay, VIC (Applied Biosystems™)

Applied Biosystems TaqMan Gene Expression assays, VIC, are used for quantitative real-time PCR analysis of gene expression and consist of a pair of unlabeled PCR primers and a TaqMan probe with a dye label (VIC) on the 5’ end and a minor groove binder (MGB) and nonfluorescent quencher (NFQ) on the 3’ end.

Features include:
Easy to use—just add cDNA and master mix and run the qPCR—no melt curves required
Specific—TaqMan assays use proprietary MGB-containing probes that can be up to 15 bases shorter than non-MGB probes, improving the specificity of the assay
Sensitive—TaqMan assays are ideal for measuring low levels of expression or low-abundance targets
Accurate—identify small fold-changes with high accuracy of quantitation
Extensive content—over 1.8 million predesigned assays available for over 25 different species
Gold-standard TaqMan qPCR chemistry—TaqMan assays draw on Thermo Fisher Scientific's bioinformatics assay design pipeline to help ensure high specificity and minimal cross-reactivity, even for gene variants with high sequence homology
Ideal for multiplexing—combine one FAM-labeled and one VIC-labeled assay to create a duplex assay for two different gene targets in the same qPCR well

Approximate ship time
Made to order: 4–6 days in North America, 6–10 days in Europe

TaqMan Gene Expression assays are the gold standard in real-time PCR gene expression studies, built on more than 20 years of experience. Each assay includes target primers and a sequence-specific probe optimized for the best functional performance. No additional design, optimization, or melt curve analysis is needed. Available in a wide variety of formats and species, new assay designs are constantly added to help meet your research needs. TaqMan assays have been cited in over 40,000 publications and are backed by more than 350 patents. All of our predesigned TaqMan Gene Expression assays are covered by the TaqMan Assays qPCR Guarantee.*

Recommended master mix: TaqMan Fast Advanced Master Mix

*Subject to terms and conditions. For complete details, go to www.thermofisher.com/taqmanguarantee.

TaqMan™ SNP Genotyping Assay, human (Applied Biosystems™)

Applied Biosystems TaqMan SNP Genotyping Assays use TaqMan 5´‑nuclease chemistry to amplify and detect specific polymorphisms in purified genomic DNA samples. Each assay enables genotyping of individuals for a single nucleotide polymorphism (SNP) and consists of two sequence-specific primers and two TaqMan minor groove binder (MGB) probes with non-fluorescent quenchers (NFQ). One probe is labeled with VIC dye to detect the Allele 1 sequence; the second probe is labeled with FAM dye to detect the Allele 2 sequence.

Our predesigned TaqMan SNP Genotyping Human Assays are a genome-wide collection of millions of human assays, including common 1,000 Genome SNPs, HapMap SNPs, and coding SNPs.

Benefits:
Proven—gold-standard TaqMan chemistry and robust assay designs deliver accurate, reproducible, and reliable results
Easy—convenient single-tube format and simple workflow provide an easy path to trusted results; no optimization required
Relevant—extensive collection of predesigned human assays offers direct access to content that is relevant to your research
Tested—all human SNP genotyping assays are functionally tested to ensure allelic discrimination

Approximate ship time
4–6 days in North America and 6–10 days in Europe

TaqMan SNP Genotyping Assays require only three reaction components for PCR: purified genomic DNA (1–20 ng), the assay solution, and TaqMan Genotyping Master Mix (or another compatible master mix) (sold separately).

All assay designs are the product of our bioinformatics pipeline, optimized over the course of more than a decade by leveraging manufacturing and assay performance data. TaqMan Assays have been cited in over 40,000 publications and are backed by more than 350 patents.

All of our predesigned TaqMan Assays are covered by the TaqMan Assays qPCR Guarantee.*

Recommended master mix (sold separately): TaqMan Genotyping Master Mix

*Terms and conditions apply. For complete details, go to www.thermofisher.com/taqmanguarantee.

Custom TaqMan™ Gene Expression Assay, VIC (Applied Biosystems™)

Applied Biosystems Custom TaqMan Gene Expression assays, VIC, are the custom version of our predesigned TaqMan assays for quantitative real-time PCR. Custom TaqMan Gene Expression assays consist of a pair of unlabeled PCR primers and a TaqMan probe with a dye label (VIC) on the 5’ end and a minor groove binder (MGB) and nonfluorescent quencher (NFQ) on the 3’ end.

Features include:
Easy to use—just add cDNA and master mix and run the qPCR—no melt curves required
Specific—TaqMan assays use proprietary MGB-containing probes that can be up to 15 bases shorter than non-MGB probes, improving the specificity of the assay
Sensitive—TaqMan assays are ideal for measuring low levels of expression or low-abundance targets
Accurate—identify small fold-changes with high accuracy of quantitation
Gold-standard TaqMan qPCR chemistry—TaqMan assays draw on Thermo Fisher Scientific's bioinformatics assay design pipeline to help ensure high specificity and minimal cross-reactivity, even for gene variants with high sequence homology
Ideal for multiplexing—combine one FAM-labeled and one VIC-labeled assay to create a duplex assay for two different gene targets in the same qPCR well
Sequences provided—with every Custom TaqMan Gene Expression you design and order

Approximate ship time
Made to order: 4–6 days in North America, 6–10 days in Europe

TaqMan Gene Expression assays are the gold standard in real-time PCR gene expression studies, built on more than 20 years of experience. Each assay includes target primers and a sequence-specific probe optimized for the best functional performance. No additional design, optimization, or melt curve analysis is needed. Available in a wide variety of formats and species, new assay designs are constantly added to help meet your research needs. TaqMan assays have been cited in over 40,000 publications and are backed by more than 350 patents.

Recommended master mix: TaqMan Fast Advanced Master Mix

See also: Custom Plus TaqMan RNA Assays, designed using the full bioinformatic power of the TaqMan Assay design pipeline.

TaqMan™ Gene Expression Assay, VIC primer-limited (Applied Biosystems™)

Applied Biosystems TaqMan Gene Expression Assays, VIC primer-limited, are used for quantitative real-time PCR analysis of gene expression and consist of a pair of unlabeled PCR primers and a TaqMan probe with a dye label (VIC) on the 5’ end and a minor groove binder (MGB) and nonfluorescent quencher (NFQ) on the 3’ end. These assays are primer-limited and ideal for multiplex reactions looking at two different gene targets in the same qPCR well.

Features include:
Easy to use—just add cDNA and master mix and run the qPCR—no melt curves required
Specific—TaqMan assays use proprietary MGB-containing probes that can be up to 15 bases shorter than non-MGB probes, improving the specificity of the assay
Sensitive—TaqMan assays are ideal for measuring low levels of expression or low-abundance targets
Accurate—identify small fold-changes with high accuracy of quantitation
Extensive content—over 1.8 million predesigned assays available for over 25 different species
Gold-standard TaqMan qPCR chemistry—TaqMan assays draw on Thermo Fisher Scientific's bioinformatics assay design pipeline to help ensure high specificity and minimal cross-reactivity, even for gene variants with high sequence homology
Ideal for multiplexing—combine one FAM-labeled and one VIC-labeled assay to create a duplex assay for two different gene targets in the same qPCR well
Ideal for control assays—use a VIC primer-limited assay for high-expressing endogenous control genes

Approximate ship time
Made to order: 4–6 days in North America, 6–10 days in Europe

TaqMan Gene Expression assays are the gold standard in real-time PCR gene expression studies, built on more than 20 years of experience. Each assay includes target primers and a sequence-specific probe optimized for the best functional performance. No additional design, optimization, or melt curve analysis is needed. Available in a wide variety of formats and species, new assay designs are constantly added to help meet your research needs. TaqMan assays have been cited in over 40,000 publications and are backed by more than 350 patents. All of our predesigned TaqMan Gene Expression assays are covered by the TaqMan Assays qPCR Guarantee.*

Recommended master mix: TaqMan Fast Advanced Master Mix

*Subject to terms and conditions. For complete details, go to www.thermofisher.com/taqmanguarantee.

TaqMan™ RNase P Assay, VIC™ dye/QSY™ probe, primer-limited (Applied Biosystems™)

The Applied Biosystems™ TaqMan™ RNase P Assay with VIC™ dye-labeled QSY™ probe provides a pre-formulated assay for quantitating human RNase P. This assay enables relative gene expression quantification in cDNA samples when used with other gene expression assays. It consists of a VIC dye-labeled QSY probe plus sequence-specific forward and reverse primers. The assay can be used for multiplex or singleplex PCR reactions and it is primer limited, so it can be used with samples that overexpress RNase P. For a primer-limited assay with ABY™ dye-labeled probe rather than VIC dye-labeled probe, see Cat. No. 4485715.

Benefits of this assay include:

• Eliminate assay design time using pre-designed primers and pre-designed VIC dye-labeled TaqMan probe
• Minimize experimental optimization time
• Use in conjunction with FAM™ dye-labeled predesigned gene expression assays
• Formulated at a primer-limited concentration for use in multiplex reactions

Save time in assay design, formulation, and testing by using the TaqMan RNase P Assay as your control when quantifying gene expression. This pre-designed probe and primer set enables you to normalize the amount of sample RNA or DNA in a reaction when used with a control sample. Or use it for relative gene expression quantification in cDNA samples when used with other gene expression assays.

In order to facilitate multiplex experiments, the assay formulation is primer limited, allowing the assay to be used with high RNase P expressors.

The VIC dye is optimized for use with the second filter of our QuantStudio™, ViiA™ 7, and 7500 series real-time PCR instruments.

TaqMan™ OpenArray™ Human Advanced MicroRNA Panel, QuantStudio™ 12K Flex (Applied Biosystems™)

The Applied Biosystems TaqMan OpenArray Human Advanced MicroRNA Panel, QuantStudio 12K Flex, is a fixed-content panel containing validated human TaqMan MicroRNA assays derived from Sanger miRBase release v.21. It enables the generation of a comprehensive miRNA profile for up to 48 samples and 43,000 data points in a single working day with minimal hands-on time and no robotics using the QuantStudio 12K Flex Real-Time PCR System.

• Take the guess-work out of assay performance with functionally validated TaqMan Advanced MicroRNA assays
• Avoid two-day workflow interruptions with a streamlined one-day procedure
• Make quicker decisions and get answers faster with 48 samples/day throughput
• Spend less time validating with miRNA panels that are highly concordant to single-tube assays
• Help save precious samples and reagent costs with nanoliter fluidics

Functionally validated TaqMan Advanced MicroRNA assays
Each TaqMan OpenArray Human Advanced MicroRNA Panel contains 754 well-characterized human miRNA sequences from the Sanger miRBase v21. All 754 assays have been functionally validated with miRNA artificial templates.

Streamlined workflow
Only about 45 minutes of hands-on time and two hours of instrument run time are needed to run four panels—the equivalent of 32 × 384-well plates—with no additional robotics required.

High-throughput miRNA profiling
For high-throughput profiling, the workflow enables up to four runs with four panels in each run over eight hours, for a total of 48 samples and over 43,000 data points in a single workday. The TaqMan OpenArray Human Advanced MicroRNA Panel provides the advantages of TaqMan Advanced MicroRNA assays in a high-throughput plate format, and is ideal for medium to large miRNA profiling studies focused on high-throughput biomarker discovery research, miRNA regulation of mRNA gene expression, and miRNA functional analysis using well-characterized and well-studied miRNAs.

Lower sample volume and reduced reagent costs
The TaqMan OpenArray Human Advanced MicroRNA Panel utilizes nanoliter fluidics, so each reaction uses only 33 nanoliters of sample and reagents, resulting in significant sample volume and reagent cost savings.

Additional required reagents
The products below are also required to run the TaqMan OpenArray Human Advanced MicroRNA Panel on the QuantStudio 12K Flex Real-Time PCR System:

TaqMan Advanced miRNA cDNA Synthesis Kit
TaqMan OpenArray Real-Time PCR Master Mix
QuantStudio 12K Flex OpenArray Accessories Kit
OpenArray AccuFill System Tips

Megaplex™ RT Primers, Human Pool B v3.0 (Applied Biosystems™)

Designed to streamline experimental workflows, Megaplex™ RT Primers provide a single reaction solution when preparing cDNA for real-time PCR analysis on a TaqMan® MicroRNA Array. Human Pool B v3.0 contains RT primers for 377 unique microRNAs and 4 controls. The microRNA targets represented in this pool tend be less well characterized, more narrowly expressed and⁄or expressed at a lower level compared to Human Pool A. Human Pool B v3.0 is intended for use with the TaqMan® Array Human MicroRNA B Card v3.0, however, it can also be used to prepare cDNA for real-time analysis using the individual TaqMan® MicroRNA Assays.

Custom Plus TaqMan™ RNA Assay, VIC primer-limited (Applied Biosystems™)

Applied Biosystems Custom Plus TaqMan RNA assays, VIC primer-limited, are the custom version of our predesigned TaqMan assays for quantitative real-time PCR. Custom Plus TaqMan RNA assays consist of a pair of unlabeled PCR primers and a TaqMan probe with a dye label (VIC) on the 5’ end and a minor groove binder (MGB) and nonfluorescent quencher (NFQ) on the 3’ end.

Features include:
Easy to use—just add cDNA and master mix and run the qPCR—no melt curves required
Specific—TaqMan assays use proprietary MGB-containing probes that can be up to 15 bases shorter than non-MGB probes, improving the specificity of the assay
Sensitive—TaqMan assays are ideal for measuring low levels of expression or low-abundance targets
Accurate—identify small fold-changes with high accuracy of quantitation
Custom content—easily design an assay for over 20 species
Ideal for multiplexing—combine one FAM-labeled and one VIC-labeled assay to create a duplex assay for two different gene targets in the same qPCR well
Ideal for control assays—use a VIC primer-limited assay for high-expressing endogenous control genes
Designed using the full bioinformatic power of the TaqMan Assay design pipeline, which uses proprietary algorithms that have generated millions of assay designs and is regarded as the benchmark in the industry for qPCR design

Approximate ship time
Made to order: 4–6 days in North America, 6–10 days in Europe

TaqMan Gene Expression assays are the gold standard in real-time PCR gene expression studies, built on more than 20 years of experience. Each assay includes target primers and a sequence-specific probe optimized for the best functional performance. No additional design, optimization, or melt curve analysis is needed. Available in a wide variety of formats and species, new assay designs are constantly added to help meet your research needs. TaqMan assays have been cited in over 40,000 publications and are backed by more than 350 patents.

Recommended master mix: TaqMan Fast Advanced Master Mix

AgriSeq™ Canine Traits and Disorders Panel (Applied Biosystems™)

The Applied Biosystems AgriSeq Canine Traits and Disorders Panel contains 154 markers targeting clinically important canine traits and disorders. The panel includes SNPs and complex markers such as MNPs and InDels. Most of these markers are common to all breeds, while some are breed-specific for certain traits and conditions. The AgriSeq Canine Traits and Disorders Panel enables multiplexed simultaneous genotyping using the AgriSeq targeted genotyping-by-sequencing (GBS) workflow. The CanFam 3.1 reference genome is used for the analysis.

The need for highly consistent detection of informative genetic markers is critical for genetic trait detection. Targeted GBS methods, like AgriSeq, have the advantage over non-targeted GBS approaches (e.g., RADSeq) that are highly susceptible to allele drop-outs and missing data. Using the AgriSeq workflow, hundreds to thousands of markers can be targeted simultaneously in a highly reproducible manner across diverse sample sets. In collaboration with multiple experts and ISAG member laboratories, we have developed and validated the performance of all markers in the panel, including 97 SNPs, 6 MNPs, 13 insertions, and 38 deletions. The performance of the panel was verified using orthogonal testing, robustness testing, and field testing with diverse canine oral swab DNA samples. The comprehensive AgriSeq Canine Traits and Disorders Panel is designed to deliver reliable genotyping results for clinically important genetic disorders and traits.

Features of the AgriSeq Canine Traits and Disorders Panel include:
• Reproducible genotyping of 154 markers targeting 136 genetic disorders and 18 traits
• Simple, high-throughput workflow
• Customizable approach to combine with compatible parentage and identification markers

>99% mean sample call rate for markers
A high genotype call rate and reproducibility are imperative to accurately predict traits and disorders. Highly diverse canine oral swab DNA field samples were evaluated using the AgriSeq targeted GBS workflow, and a 99.5% mean sample call rate was obtained for a majority of the markers (see figure below). Replicate genotype concordance was >99.9% and calls were highly concordant with orthogonal data (>99%).

Simple, high throughput workflow
The AgriSeq Canine Traits and Disorders Panel has been optimized for use in the AgriSeq targeted GBS workflow. Up to 768 unique samples can be pooled per chip, greatly reducing the sequencing cost and labor per animal. Up to four 384-well plates can be processed in a single day and full sequencing results can be obtained in as little as three days. The flexibility of the AgriSeq workflow allows hundreds of samples to be pooled together into a single sequencing run targeting hundreds to thousands of markers.

Combine with Canine Parentage & Identification panel or customize panel with additional markers for maximal test value
The AgriSeq targeted GBS workflow is highly flexible, allowing the addition of compatible markers and panels for efficient, high-value genotyping. Whether you are looking to combine parentage analysis with specific desired trait markers or genetic defect markers to cull out carriers in breeding programs, our dedicated team of agrigenomics bioinformatics specialists is available to help design high performance panels.

The AgriSeq Canine Traits and Disorders panel, along with the AgriSeq workflow, provides a streamlined, cost-effective method for canine genotyping for traits and disorders.

NOTE: The CanFam 3.1 reference genome and other files needed for analysis of the AgriSeq Canine Traits and Disorder Panel can be obtained by contacting technical support.

TaqMan™ OpenArray™ Vaginal Microbiota Comprehensive Plate (Applied Biosystems™)

The TaqMan OpenArray Vaginal Microbiota Comprehensive Plate is an efficient, easy-to-use OpenArray plate (112-assay format) for the characterization of key vaginal microbial targets through real-time PCR. This plate contains TaqMan Gene Expression Assays for 34 microbial targets, plus prokaryotic 16S rRNA and human RNase P RPPH1 controls. The format of this OpenArray plate allows for three replicates to be run in parallel per plate for all microbial targets and five replicates for the controls.

Custom TaqMan™ Gene Expression Assay, VIC primer-limited (Applied Biosystems™)

Applied Biosystems Custom TaqMan Gene Expression assays, VIC primer-limited, are the custom version of our predesigned TaqMan assays for quantitative real-time PCR. Custom TaqMan Gene Expression assays consist of a pair of unlabeled PCR primers and a TaqMan probe with a dye label (VIC) on the 5’ end and a minor groove binder (MGB) and nonfluorescent quencher (NFQ) on the 3’ end.

Features include:
Easy to use—just add cDNA and master mix and run the qPCR—no melt curves required
Specific—TaqMan assays use proprietary MGB-containing probes that can be up to 15 bases shorter than non-MGB probes, improving the specificity of the assay
Sensitive—TaqMan assays are ideal for measuring low levels of expression or low-abundance targets
Accurate—identify small fold-changes with high accuracy of quantitation
Gold-standard TaqMan qPCR chemistry—TaqMan assays draw on Thermo Fisher Scientific's bioinformatics assay design pipeline to help ensure high specificity and minimal cross-reactivity, even for gene variants with high sequence homology
Ideal for multiplexing—combine one FAM-labeled and one VIC-labeled assay to create a duplex assay for two different gene targets in the same qPCR well
Ideal for control assays—use a VIC primer-limited assay for high-expressing endogenous control genes
Sequences provided—with every Custom TaqMan Gene Expression you design and order

Approximate ship time
Made to order: 4–6 days in North America, 6–10 days in Europe

TaqMan Gene Expression assays are the gold standard in real-time PCR gene expression studies, built on more than 20 years of experience. Each assay includes target primers and a sequence-specific probe optimized for the best functional performance. No additional design, optimization, or melt curve analysis is needed. Available in a wide variety of formats and species, new assay designs are constantly added to help meet your research needs. TaqMan assays have been cited in over 40,000 publications and are backed by more than 350 patents.

Recommended master mix: TaqMan Fast Advanced Master Mix

See also: Custom Plus TaqMan RNA Assays, designed using the full bioinformatic power of the TaqMan Assay design pipeline.

Random Decamers (50 µM) (Invitrogen™)

Random Decamers are the same primers currently included in the RETROscript® Kit (Cat. No. AM1710). They are provided at a stock concentration of 50 µM, and are functionally tested using the RETROscript® Kit.

Using random primers
Generally, reverse transcription reactions are primed with one of the following types of primers: random sequence oligonucleotides, oligo(dT), or an oligonucleotide that can hybridize with the specific RNA under study. The type of first-strand primer used for reverse transcription is mostly based on user preference. For cDNA library construction or cDNA labeling applications, oligo(dT) is almost always used to prime cDNA synthesis, so that the cDNA will start at the poly(A) tail. The greatest yield of RT product is usually obtained by using short random oligonucleotides to prime the reverse transcription, but this yield advantage may not be seen after the PCR step. When template is limiting, final RT-PCR yield may be somewhat higher when the reverse transcription is primed with random primers as opposed to oligo(dT) or gene-specific primers.

TaqMan™ SNP Genotyping Assay, mouse (Applied Biosystems™)

Applied Biosystems TaqMan SNP Genotyping Assays use TaqMan 5´‑nuclease chemistry to amplify and detect specific polymorphisms in purified genomic DNA samples. Each assay enables genotyping of individuals for a single nucleotide polymorphism (SNP), and consists of two sequence-specific primers and two TaqMan minor groove binder (MGB) probes with non-fluorescent quenchers (NFQ). One probe is labeled with VIC dye to detect the Allele 1 sequence; the second probe is labeled with FAM dye to detect the Allele 2 sequence.

The predesigned TaqMan SNP Genotyping Mouse Assay collection consists of over 10,000 assays. For targets of interest that are not covered by the predesigned assay collection, Custom TaqMan SNP Genotyping Assays are available to meet your research needs.

Benefits:
Proven—gold-standard TaqMan chemistry and robust assay designs deliver accurate, reproducible, and reliable results
Easy—convenient single-tube format and simple workflow provide an easy path to trusted results; no optimization required
Guaranteed—if you are not satisfied with the performance of a TaqMan Assay, we’ll replace it at no cost, or credit your account*

Approximate ship time
4–6 days in North America and 6–10 days in Europe

TaqMan SNP Genotyping Assays require only three reaction components for PCR: purified genomic DNA (1–20 ng), the assay solution, and TaqMan Genotyping Master Mix (or another compatible master mix) (sold separately).

All assay designs are the product of our bioinformatics pipeline, optimized over the course of more than a decade by leveraging manufacturing and assay performance data. TaqMan Assays have been cited in over 40,000 publications and are backed by more than 350 patents.

All of our predesigned TaqMan Assays are covered by the TaqMan Assays qPCR Guarantee.*

Recommended master mix (sold separately): TaqMan Genotyping Master Mix

*Terms and conditions apply. For complete details, go to www.thermofisher.com/taqmanguarantee.

T3 promoter Sequencing Primer, 24-mer (Thermo Scientific™)

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T3 RNA Polymearse promoter region and are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments located downstream from the T3 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO119—T3 promoter sequencing primer, 17-mer 5'-d (ATTAACCCTCACTAAAG)-3'
• SO120—T3 promoter sequencing primer, 24-mer 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3'

Note
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
SP6 promoter Sequencing Primer, 18-mer
T3 promoter Sequencing Primer, 17-mer
SP6 promoter Sequencing Primer, 24-mer
T7 promoter Sequencing Primer, 20-mer