Shop All DNA Primers & Oligos

GeneChip™ T7-Oligo(dT) Promoter Primer Kit Applied Biosystems™

This reagent kit is an essential component of the eukaryotic target labeling procedure for expression analysis using GeneChip™ probe arrays. It contains 50 µM T7-Oligo(dT) promoter primer and RNase-free water.

Each T7-Oligo(dT) Promoter Primer Kit provides sufficient primer for 150 labeling reactions. All components are ready to be added directly to RNA samples to initiate the first strand cDNA synthesis reaction. This reagent kit has been tested, is quality assured, and is able to sustain at least twenty-five freeze-thaw cycles without compromise to its performance.

For more information, please review the data sheet (152 KB).

TaqMan™ QSY Probe Applied Biosystems™

Applied Biosystems TaqMan QSY probes are dual-labeled probes used for real-time PCR. TaqMan QSY Probes are designed for optimal sensitivity and performance in multiplex qPCR experiments. Current users of dark quencher probes, such as Black Hole Quencher (BHQ™) probes, can design custom QSY probes without changing probe sequences.

All TaqMan QSY probes are HPLC-purified and verified by mass spectrometry to help ensure lot-to-lot reproducibility between batches. Thermo Fisher Scientific has been a leader in qPCR probe manufacturing for over 20 years, with expertise in probe synthesis in a facility that is certified to ISO 13485.

Features of TaqMan QSY probes include:
Sensitivity—lower background and increased signal result in better sensitivity
Multiplexing performance without compromise—successfully multiplex multiple gene targets in a single reaction
Dye options ideal for Applied Biosystems qPCR instrument filters—TaqMan qPCR dyes are designed for optimal alignment with Applied Biosystems qPCR instruments, enabling improved fluorescence signal, especially for low-expressing gene targets
Flexibility—mix and match your multiplex qPCR probes with up to two MGB probes or four QSY probes in a single reaction
Get started quickly—BHQ probe sequences can be converted to QSY versions with no redesign needed
Performance without compromise
Multiplexing with TaqMan QSY probes enables cost savings and preservation of limited samples, and has been shown to yield comparable results between reactions performed in individual tubes and in 4-plex reactions for gene quantification.

Learn more about multiplex real-time PCR ›

Guaranteed yield
The unit size you select is based on the minimum amount we will deliver, not on synthesis starting amount.

Approximate ship time
4–6 days in North America, 5-10 days in Europe

We also offer Applied Biosystems custom primers and other types of TaqMan probes. Learn more ›

Need a different dye or concentration or a larger lot size? The TaqMan Custom Assay and Oligo Service offers custom products that you can tailor to meet your experimental needs. Learn more ›

Custom Plus TaqMan™ RNA Assay, FAM Applied Biosystems™

Applied Biosystems Custom Plus TaqMan RNA assays, are the custom version of our predesigned TaqMan assays for quantitative real-time PCR. Custom Plus TaqMan RNA assays consist of a pair of unlabeled PCR primers and a TaqMan probe with a dye label (FAM) on the 5’ end and a minor groove binder (MGB) and nonfluorescent quencher (NFQ) on the 3’ end.

Features include:
Easy to use—just add cDNA and master mix and run the qPCR—no melt curves required
Specific—TaqMan assays use proprietary MGB-containing probes that can be up to 15 bases shorter than non-MGB probes, improving the specificity of the assay
Sensitive—TaqMan assays are ideal for measuring low levels of expression or low-abundance targets
Accurate—identify small fold-changes with high accuracy of quantitation
Custom content—easily design an assay for over 20 species
Designed using the full bioinformatic power of the TaqMan Assay design pipeline, which uses proprietary algorithms that have generated millions of assay designs and is regarded as the benchmark in the industry for qPCR design

Approximate ship time
Made to order: 4–6 days in North America, 6–10 days in Europe

TaqMan Gene Expression assays are the gold standard in real-time PCR gene expression studies, built on more than 20 years of experience. Each assay includes target primers and a sequence-specific probe optimized for the best functional performance. No additional design, optimization, or melt curve analysis is needed. Available in a wide variety of formats and species, new assay designs are constantly added to help meet your research needs. TaqMan assays have been cited in over 40,000 publications and are backed by more than 350 patents.

Recommended master mix: TaqMan Fast Advanced Master Mix

TaqMan™ OpenArray™ Respiratory Tract Microbiota Plate Applied Biosystems™

TaqMan® OpenArray™ Respiratory Tract Microbiota Plate is an efficient, easy-to-use OpenArray plate (112-assay format) for the characterization of key respiratory tract microbial targets through real-time PCR. This plate contains TaqMan Microbial Assays for 31 microbial targets, plus Universal Extraction Organism Control (B. atropheus), Universal DNA Spike-In Positive Control (Xeno) and human RNase P RPPH1 control. The format of this OpenArray plate allows for three replicates to be run in parallel per plate for all targets and two replicates for B. atropheus and RNase P. Each OpenArray can be used for running 23 samples and 1 control sample.

M13/pUC Reverse Sequencing Primer (-26), 17-mer Thermo Scientific™

Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

Custom TaqMan™ Small RNA Assay Applied Biosystems™

Custom TaqMan Small RNA Assays use TaqMan Real-Time PCR Assays for the analysis of any small RNA molecule. The novel adaptations in TaqMan Assay design developed for the study of miRNAs are ideal for analysis of any small nucleic acid less than 200 bases long, including newly discovered miRNAs, Piwi-interacting RNA (piRNA), small nuclear RNA (snRNA), and small nucleolar RNA (snoRNA).

Flexible and convenient ordering—easy process with our secure Custom TaqMan Small RNA Assay design tool
Versatile application—use for the analysis of any small RNA from any species
Reliable outcome—pre-formulated assays are optimized to run under universal conditions
Powerful miRNA quantitation—the same sensitivity, specificity, and reproducibility as predesigned TaqMan MicroRNA Assays

Sophisticated design pipeline
The miRPipe Small RNA Assay design pipeline is founded on our extensive background and bioinformatics expertise designing TaqMan Gene Expression Assays. To detect very small targets, it includes design features based on empirical data gathered over years of experiments. The resulting automated pipeline includes built-in flexibility features enabling design of assays for the broadest assortment of small RNA sequences. The benefits of TaqMan Assay technology are ideal for analysis of virtually any small RNA, enabling results you can trust from the very first experiment.

Ordering information
First, bioinformatically qualify your sequence target for specificity and sequence quality, then use the Custom TaqMan Small RNA Assay Design Tool to input your sequence and submit it for assay design. This easy-to-use tool is a secure and confidential. If we are unable to design or manufacture an assay for your sequence target of interest, you will not be charged.

GeneChip™ Poly-A RNA Control Kit Applied Biosystems™

The GeneChip™ Poly-A RNA Control Kit is used with the Prokaryotic Target Labeling Assay and the Prokaryotic Target Labeling Assay for 3' expression studies with prokaryotic GeneChip Brand Arrays. The assays utilize reverse transcriptase and random hexamer primers to produce DNA complementary to the RNA. The cDNA products are then fragmented by DNase I and labeled with terminal transferase and biotinylated GeneChip DNA Labeling Reagent at the 3' termini.

Functionally tested on GeneChip Brand Arrays, we recommend the Prokaryotic Target Labeling Assay and associated reagents for use in prokaryotic gene expression studies.

Prokaryotic Target Labeling Assay components include:
B2 Control Oligo (3nM)
GeneChip DNA Labeling Reagent
GeneChip Poly-A RNA Control Kit

Related Links
GeneChip™ Wash Buffer A
GeneChip™ Wash Buffer B

TaqMan™ Gene Expression Assay, VIC Applied Biosystems™

Applied Biosystems TaqMan Gene Expression assays, VIC, are used for quantitative real-time PCR analysis of gene expression and consist of a pair of unlabeled PCR primers and a TaqMan probe with a dye label (VIC) on the 5’ end and a minor groove binder (MGB) and nonfluorescent quencher (NFQ) on the 3’ end.

Features include:
Easy to use—just add cDNA and master mix and run the qPCR—no melt curves required
Specific—TaqMan assays use proprietary MGB-containing probes that can be up to 15 bases shorter than non-MGB probes, improving the specificity of the assay
Sensitive—TaqMan assays are ideal for measuring low levels of expression or low-abundance targets
Accurate—identify small fold-changes with high accuracy of quantitation
Extensive content—over 1.8 million predesigned assays available for over 25 different species
Gold-standard TaqMan qPCR chemistry—TaqMan assays draw on Thermo Fisher Scientific's bioinformatics assay design pipeline to help ensure high specificity and minimal cross-reactivity, even for gene variants with high sequence homology
Ideal for multiplexing—combine one FAM-labeled and one VIC-labeled assay to create a duplex assay for two different gene targets in the same qPCR well

Approximate ship time
Made to order: 4–6 days in North America, 6–10 days in Europe

TaqMan Gene Expression assays are the gold standard in real-time PCR gene expression studies, built on more than 20 years of experience. Each assay includes target primers and a sequence-specific probe optimized for the best functional performance. No additional design, optimization, or melt curve analysis is needed. Available in a wide variety of formats and species, new assay designs are constantly added to help meet your research needs. TaqMan assays have been cited in over 40,000 publications and are backed by more than 350 patents. All of our predesigned TaqMan Gene Expression assays are covered by the TaqMan Assays qPCR Guarantee.*

Recommended master mix: TaqMan Fast Advanced Master Mix

*Subject to terms and conditions. For complete details, go to www.thermofisher.com/taqmanguarantee.

T7 promoter Sequencing Primer, 20-mer Thermo Scientific™

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments located downstream from the T7 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO118—T7 promoter sequencing primer, 20-mer 5'-d (TAATACGACTCACTATAGGG)-3'
Note
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
T3 promoter Sequencing Primer, 17-mer
SP6 promoter Sequencing Primer, 24-mer
T3 promoter Sequencing Primer, 24-mer
SP6 promoter Sequencing Primer, 18-mer

TaqMan™ SNP Genotyping Assay, human Applied Biosystems™

Applied Biosystems TaqMan SNP Genotyping Assays use TaqMan 5´‑nuclease chemistry to amplify and detect specific polymorphisms in purified genomic DNA samples. Each assay enables genotyping of individuals for a single nucleotide polymorphism (SNP) and consists of two sequence-specific primers and two TaqMan minor groove binder (MGB) probes with non-fluorescent quenchers (NFQ). One probe is labeled with VIC dye to detect the Allele 1 sequence; the second probe is labeled with FAM dye to detect the Allele 2 sequence.

Our predesigned TaqMan SNP Genotyping Human Assays are a genome-wide collection of millions of human assays, including common 1,000 Genome SNPs, HapMap SNPs, and coding SNPs.

Benefits:
Proven—gold-standard TaqMan chemistry and robust assay designs deliver accurate, reproducible, and reliable results
Easy—convenient single-tube format and simple workflow provide an easy path to trusted results; no optimization required
Relevant—extensive collection of predesigned human assays offers direct access to content that is relevant to your research
Tested—all human SNP genotyping assays are functionally tested to ensure allelic discrimination

Approximate ship time
4–6 days in North America and 6–10 days in Europe

TaqMan SNP Genotyping Assays require only three reaction components for PCR: purified genomic DNA (1–20 ng), the assay solution, and TaqMan Genotyping Master Mix (or another compatible master mix) (sold separately).

All assay designs are the product of our bioinformatics pipeline, optimized over the course of more than a decade by leveraging manufacturing and assay performance data. TaqMan Assays have been cited in over 40,000 publications and are backed by more than 350 patents.

All of our predesigned TaqMan Assays are covered by the TaqMan Assays qPCR Guarantee.*

Recommended master mix (sold separately): TaqMan Genotyping Master Mix

*Terms and conditions apply. For complete details, go to www.thermofisher.com/taqmanguarantee.

Custom Plus TaqMan™ RNA Assay, VIC primer-limited Applied Biosystems™

Applied Biosystems Custom Plus TaqMan RNA assays, VIC primer-limited, are the custom version of our predesigned TaqMan assays for quantitative real-time PCR. Custom Plus TaqMan RNA assays consist of a pair of unlabeled PCR primers and a TaqMan probe with a dye label (VIC) on the 5’ end and a minor groove binder (MGB) and nonfluorescent quencher (NFQ) on the 3’ end.

Features include:
Easy to use—just add cDNA and master mix and run the qPCR—no melt curves required
Specific—TaqMan assays use proprietary MGB-containing probes that can be up to 15 bases shorter than non-MGB probes, improving the specificity of the assay
Sensitive—TaqMan assays are ideal for measuring low levels of expression or low-abundance targets
Accurate—identify small fold-changes with high accuracy of quantitation
Custom content—easily design an assay for over 20 species
Ideal for multiplexing—combine one FAM-labeled and one VIC-labeled assay to create a duplex assay for two different gene targets in the same qPCR well
Ideal for control assays—use a VIC primer-limited assay for high-expressing endogenous control genes
Designed using the full bioinformatic power of the TaqMan Assay design pipeline, which uses proprietary algorithms that have generated millions of assay designs and is regarded as the benchmark in the industry for qPCR design

Approximate ship time
Made to order: 4–6 days in North America, 6–10 days in Europe

TaqMan Gene Expression assays are the gold standard in real-time PCR gene expression studies, built on more than 20 years of experience. Each assay includes target primers and a sequence-specific probe optimized for the best functional performance. No additional design, optimization, or melt curve analysis is needed. Available in a wide variety of formats and species, new assay designs are constantly added to help meet your research needs. TaqMan assays have been cited in over 40,000 publications and are backed by more than 350 patents.

Recommended master mix: TaqMan Fast Advanced Master Mix

TaqMan™ Gene Expression Assay, VIC primer-limited Applied Biosystems™

Applied Biosystems TaqMan Gene Expression Assays, VIC primer-limited, are used for quantitative real-time PCR analysis of gene expression and consist of a pair of unlabeled PCR primers and a TaqMan probe with a dye label (VIC) on the 5’ end and a minor groove binder (MGB) and nonfluorescent quencher (NFQ) on the 3’ end. These assays are primer-limited and ideal for multiplex reactions looking at two different gene targets in the same qPCR well.

Features include:
Easy to use—just add cDNA and master mix and run the qPCR—no melt curves required
Specific—TaqMan assays use proprietary MGB-containing probes that can be up to 15 bases shorter than non-MGB probes, improving the specificity of the assay
Sensitive—TaqMan assays are ideal for measuring low levels of expression or low-abundance targets
Accurate—identify small fold-changes with high accuracy of quantitation
Extensive content—over 1.8 million predesigned assays available for over 25 different species
Gold-standard TaqMan qPCR chemistry—TaqMan assays draw on Thermo Fisher Scientific's bioinformatics assay design pipeline to help ensure high specificity and minimal cross-reactivity, even for gene variants with high sequence homology
Ideal for multiplexing—combine one FAM-labeled and one VIC-labeled assay to create a duplex assay for two different gene targets in the same qPCR well
Ideal for control assays—use a VIC primer-limited assay for high-expressing endogenous control genes

Approximate ship time
Made to order: 4–6 days in North America, 6–10 days in Europe

TaqMan Gene Expression assays are the gold standard in real-time PCR gene expression studies, built on more than 20 years of experience. Each assay includes target primers and a sequence-specific probe optimized for the best functional performance. No additional design, optimization, or melt curve analysis is needed. Available in a wide variety of formats and species, new assay designs are constantly added to help meet your research needs. TaqMan assays have been cited in over 40,000 publications and are backed by more than 350 patents. All of our predesigned TaqMan Gene Expression assays are covered by the TaqMan Assays qPCR Guarantee.*

Recommended master mix: TaqMan Fast Advanced Master Mix

*Subject to terms and conditions. For complete details, go to www.thermofisher.com/taqmanguarantee.

M13/pUC Sequencing Primer (-40), 17-mer Thermo Scientific™

Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

TaqMan™ MicroRNA Assay Applied Biosystems™

Applied Biosystems TaqMan MicroRNA Assays quantitate miRNAs with the specificity and sensitivity of TaqMan Assay chemistry. A simple, two-step protocol requires only reverse transcription with an miRNA-specific primer, followed by real-time PCR with TaqMan probes. TaqMan MicroRNA Assays are:

Highly specific—quantitate only mature miRNAs, not precursors
Sensitive—conserve limited samples, requires only 1–10 nanograms of total RNA or equivalent
Fast, simple and scalable—two-step quantitative RT-PCR assay provides high-quality results in less than three hours

Our TaqMan MicroRNA Assay catalogue is kept up to date with the Sanger database to provide comprehensive coverage with the most current annotation.

Availability and sizes
Made-to-Order assays are available in four different sizes and usually ship within two weeks. Inventoried assays are prepackaged in Small size and are ready to ship. Inventoried assays may be purchased in larger sizes by ordering them as Made to Order.

Species
TaqMan MicroRNA Assays are available for a range of species including human, mouse, rat, Drosophila, C. elegans, and Arabidopsis. We will continue to increase the number of miRNA assays for these species in alignment with the Sanger miRBase Registry.

Assay Components
TaqMan MicroRNA Assays are delivered in two tubes: one containing the RT primer, the other containing the specific pre-formulated TaqMan Assay (TaqMan probe and PCR primer set).

TaqMan miRNA Assay selection guide

 TaqMan MicroRNA AssaysTaqMan Advanced miRNA Assays
DescriptionTaqMan MicroRNA Assays employ a novel target-specific stem–loop primer during cDNA synthesis to produce a template for real-time PCRTaqMan Advanced miRNA Assays employ a universal RT step for a streamlined workflow, and a universal miR-Amp step to enable highly sensitive detection by real-time PCR
RT chemistrymiRNA-specific RTUniversal RT
ThroughputBest for 1–10 targetsBest for >10 targets
Coverage205 species available, coverage for miRBase v.21All human, mouse, and rat miRNAs; coverage for miRBase v.21

Tag Sequencing Barcode Set 25-48 Ion Torrent™

The Tag Sequencing Barcode Set 25-48 provides a set of 24 unique barcode adapters specifically designed for optimal performance in Oncomine™ cfDNA assays. The barcode adapters are compatible with the Ion S5™, Ion PGM™, and Ion Proton™ sequencing systems. When used in combination with kits utilizing tag sequencing technology, this barcode set enables users to pool up to 24 amplicon libraries and to conduct multiplexed next-generation sequencing (NGS) analysis, reducing the sequencing cost per sample.

Key product features:
• Enables multiplexing of numerous amplicon library samples on a single sequencing chip with the use of robust molecular barcodes
• Both sequence-optimized and flow-optimized for equal representation of all barcodes in a pool and more economical multiplexed sequencing runs
• Compatible with library construction kits utilizing tag sequencing technology

Multiplexing with barcode adapters enables higher throughput
Multiplexing with barcoded libraries leads to more cost-effective runs by permitting up to 24 samples per run (or more if combined with Tag Sequencing BC Set 1-24, Cat. No. A31830), significantly decreasing the cost and handling requirements of sequencing. Each barcode was individually tested to minimize representation bias.

Sequence-optimized and flow-optimized for increased performance and efficiency
Barcode adapters contain sequences that are optimized to provide equal representation of all barcodes in a pool; they require a minimal number of flows to interrogate resulting in more economical multiplexed sequencing runs.

Results per page
    spinner