Sort By

MERTK Monoclonal Antibody (DS5MMER), Super Bright 436, eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Flow

MERTK Monoclonal Antibody (A3KCAT), eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for IHC (P)

MERTK Monoclonal Antibody (DS5MMER), Functional Grade, eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Western Blot, IHC (F), Flow, IP, FN

MerTK Monoclonal Antibody (DS5MMER), PerCP-eFluor 710, eBioscience™ (Invitrogen™)

MerTK Monoclonal Antibody for Flow

MERTK Monoclonal Antibody (HMER5DS), APC, eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Flow

T3 promoter Sequencing Primer, 24-mer (Thermo Scientific™)

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T3 RNA Polymearse promoter region and are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments located downstream from the T3 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO119—T3 promoter sequencing primer, 17-mer 5'-d (ATTAACCCTCACTAAAG)-3'
• SO120—T3 promoter sequencing primer, 24-mer 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3'

Note
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
SP6 promoter Sequencing Primer, 18-mer
T3 promoter Sequencing Primer, 17-mer
SP6 promoter Sequencing Primer, 24-mer
T7 promoter Sequencing Primer, 20-mer

M13/pUC sequencing primer (-20), 17-mer (Thermo Scientific™)

Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

M13/pUC Reverse Sequencing Primer (-26), 17-mer (Thermo Scientific™)

Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

M13/pUC Sequencing Primer (-40), 17-mer (Thermo Scientific™)

Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

M13/pUC Sequencing Primer (-46), 22-mer (Thermo Scientific™)

Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

pJET1.2 Forward Sequencing Primer, 23-mer (Thermo Scientific™)

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2pJET1.2 sequence sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR

Catalog number and Primer sequence:
• SO501—pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• SO511—pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'

Related Products
pJET1.2 Reverse Sequencing Primer, 24-mer

M13/pUC Reverse Sequencing Primer (-46), 24-mer (Thermo Scientific™)

Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

SP6 promoter Sequencing Primer, 24-mer (Thermo Scientific™)

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the SP6 RNA Polymerase promoter region and are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO116—SP6 promoter sequencing primer, 18-mer 5'-d (ATTTAGGTGACACTATAG)-3'
• SO117—SP6 promoter sequencing primer, 24-mer 5'-d (CATACGATTTAGGTGACACTATAG)-3'
Note
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
SP6 promoter Sequencing Primer, 18-mer
T7 promoter Sequencing Primer, 20-mer
T3 promoter Sequencing Primer, 17-mer
T3 promoter Sequencing Primer, 24-mer

pJET1.2 Reverse Sequencing Primer, 24-mer (Thermo Scientific™)

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2pJET1.2 sequence sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR

Catalog number and Primer sequence:
• SO501—pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• SO511—pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'

Related Products
pJET1.2 Forward Sequencing Primer, 23-mer

T3 promoter Sequencing Primer, 17-mer (Thermo Scientific™)

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T3 RNA Polymearse promoter region and are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments located downstream from the T3 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO119—T3 promoter sequencing primer, 17-mer 5'-d (ATTAACCCTCACTAAAG)-3'
• SO120—T3 promoter sequencing primer, 24-mer 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3'

Note
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
T3 promoter Sequencing Primer, 24-mer
T7 promoter Sequencing Primer, 20-mer
SP6 promoter Sequencing Primer, 18-mer
SP6 promoter Sequencing Primer, 24-mer