Sort By

T3 promoter Sequencing Primer, 17-mer (Thermo Scientific™)

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T3 RNA Polymearse promoter region and are supplied as 10 µM aqueous solutions.


• Sequencing of DNA fragments located downstream from the T3 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO119—T3 promoter sequencing primer, 17-mer 5'-d (ATTAACCCTCACTAAAG)-3'
• SO120—T3 promoter sequencing primer, 24-mer 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3'

• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
T3 promoter Sequencing Primer, 24-mer
T7 promoter Sequencing Primer, 20-mer
SP6 promoter Sequencing Primer, 18-mer
SP6 promoter Sequencing Primer, 24-mer

T7 promoter Sequencing Primer, 20-mer (Thermo Scientific™)

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 µM aqueous solutions.


• Sequencing of DNA fragments located downstream from the T7 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO118—T7 promoter sequencing primer, 20-mer 5'-d (TAATACGACTCACTATAGGG)-3'
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
T3 promoter Sequencing Primer, 17-mer
SP6 promoter Sequencing Primer, 24-mer
T3 promoter Sequencing Primer, 24-mer
SP6 promoter Sequencing Primer, 18-mer

MERTK Polyclonal Antibody (Invitrogen™)

MERTK Polyclonal Antibody for Western Blot

Phospho-MER/SKY (Tyr749, Tyr681) Polyclonal Antibody (Invitrogen™)

Phospho-MER/SKY (Tyr749, Tyr681) Polyclonal Antibody for Western Blot

MerTK/c-mer Polyclonal Antibody (Bethyl Laboratories)

MerTK/c-mer Polyclonal Antibody for Western Blot

MERTK Polyclonal Antibody (Invitrogen™)

MERTK Polyclonal Antibody for Western Blot

MERTK Recombinant Rabbit Monoclonal Antibody (SR29-07) (Invitrogen™)

MERTK Recombinant Monoclonal Antibody for Western Blot, IHC

MerTK/c-mer Polyclonal Antibody (Bethyl Laboratories)

MerTK/c-mer Polyclonal Antibody for Western Blot

MERTK (cMER) [A708S] Recombinant Human Protein

MERTK (c-MER) is a member of the TYRO3/AXL/MER (TAM) receptor kinase family which encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Cytokine-dependent activation of TAM signaling diverts a proinflammatory pathway to provide an intrinsic feedback inhibitor of both TLR- and cytokine-driven immune responses. MERTK is essential regulators of mammalian spermatogenesis. Mutations in MERTK gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). Recombinant human MERTK A708S (578-872) was expressed by baculovirus in Sf9 insect cells using an N-terminal GST tag.

• Validated in LanthaScreen® Kinase Binding Assay
• Protocols available for simple use and optimized performance
• Multiple pack sizes available for convenient use

Related Product:
LanthaScreen® Eu Kinase Binding Assay

MERTK (cMER) Recombinant Human Protein

MERTK (cMER) is a tyrosine kinase proto-oncogene and is involved in the retinal pigment epithelium (RPE) phagocytosis pathway, which is implicated in human retinal disease.

MER (MerTK) Human ProcartaPlex™ Simplex Kit (Invitrogen™)

The Human MER Simplex ProcartaPlex kit measures MER protein and is designed to be combinable with other Simplex kits so that you can create your own multiplex panel that utilizes Luminex xMAP technology for protein detection/quantitation. When combining multiple Simplex kits (i.e., when you are not using a pre-configured Multiplex Panel), only one buffer kit (sold separately) is needed for each assay plate regardless of plex size.

ProcartaPlex immunoassays are based on the principles of a sandwich ELISA, using two highly specific antibodies binding to different epitopes of one protein to quantitate up to 80 protein targets simultaneously when using the FLEXMAP 3D or Luminex 200 instrument and up to 50 protein targets when using the MAGPIX instrument. ProcartaPlex assays require as little as 25 µL of plasma or serum, or 50 µL of cell culture supernatant, and just four hours to obtain analyzed results.

Flexible panels—design your own panels with Simplex kits to measure your own array of targets
More results per sample—measure up to 80 protein targets in a single 25–50 µL sample
Well-established Luminex technology—the most referenced multiplexing platform for protein detection and quantitation

The Luminex MagPlex superparamagnetic microsphere beads in the ProcartaPlex assay are internally dyed with precise proportions of red and infrared fluorophores to create 100 spectrally unique signatures that can be identified by the Luminex xMAP detec¬tion systems (Luminex 200, FLEXMAP 3D, and MAGPIX systems). Similar to a sandwich ELISA, the ProcartaPlex assay uses matched antibody pairs to identify the protein of interest. In a ProcartaPlex multiplex assay, each spectrally unique bead is labeled with antibodies specific for a single target protein, and bound proteins are identified with biotinylated antibodies and streptavidin–R-phycoerythrin (RPE). The conjugation of protein-specific antibodies to a distinct bead allows for analysis of multiple targets in a single well.

The most significant difference between a ProcartaPlex assay and ELISA is that the capture antibody in the ProcartaPlex assay is conjugated to a magnetic bead and not adsorbed to the microplate well, so the ProcartaPlex assay reagents are free-floating in the solution. For detection, the Luminex 200 instrument, for example, contains two lasers, one to distinguish the spectral signature of each bead and the second to quantify the amount of RPE fluorescence, which is proportional to the amount of protein present in the sample. ProcartaPlex multiplex assays can profile up to 80 times more target proteins using significantly less sample in the same time that it takes to perform a traditional sandwich ELISA.

ProcartaPlex Simplex kits provide the ability to create your own unique panel . More than 90% of ProcartaPlex Simplex targets can be combined, providing you with superior flexibility when creating your own multiplex panel.

ProcartaPlex Simplex kits are available across six species (human, mouse, rat, nonhuman primate, porcine, and canine). Visit for more information, including a comprehensive list of individual protein targets.

Reactivity/species: human
Suitable sample types: cell culture supernatant, serum, plasma
Sample volume: serum, plasma: 25 µL; CCS: 50 µL
Reported application: multiplex immunoassay

MERTK Polyclonal Antibody (Invitrogen™)

MERTK Polyclonal Antibody for Western Blot, IHC (P)

MERTK Polyclonal Antibody (Invitrogen™)

MERTK Polyclonal Antibody for Western Blot, IF, ICC, IHC (P), Flow

MERTK Monoclonal Antibody (7E5G1) (Invitrogen™)

MERTK Monoclonal Antibody for Western Blot

Phospho-MER/SKY (Tyr749, Tyr681) Polyclonal Antibody (Invitrogen™)

Phospho-MER/SKY (Tyr749, Tyr681) Polyclonal Antibody for Western Blot, IHC (P)