Sort By

MERTK Monoclonal Antibody (HMER5DS), Alexa Fluor 488, eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Flow

MerTK Monoclonal Antibody (DS5MMER), PerCP-eFluor 710, eBioscience™ (Invitrogen™)

MerTK Monoclonal Antibody for Flow

MERTK Monoclonal Antibody (DS5MMER), Super Bright 600, eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Flow

MERTK Monoclonal Antibody (A3KCAT), eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for IHC (P)

MERTK Monoclonal Antibody (DS5MMER), APC, eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Flow

MERTK Monoclonal Antibody (DS5MMER), Super Bright 436, eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Flow

MERTK Monoclonal Antibody (DS5MMER), PE, eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Flow

MERTK Monoclonal Antibody (HMER5DS), PE, eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Flow

MERTK Monoclonal Antibody (DS5MMER), Alexa Fluor 488, eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Flow

MERTK Monoclonal Antibody (DS5MMER), Super Bright 645, eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Flow

MERTK Monoclonal Antibody (HMER5DS), APC, eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Flow

MERTK Monoclonal Antibody (DS5MMER), Alexa Fluor 700, eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Flow

Mer (MERTK) Human ELISA Kit (Invitrogen™)

Mer (MERTK) Human ELISA Kit

MERTK Monoclonal Antibody (DS5MMER), Functional Grade, eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Western Blot, IHC (F), Flow, IP, FN

Mer (MERTK) Human ELISA Kit (Invitrogen™)

Mer (MERTK) Human ELISA Kit for ELISA

MERTK Monoclonal Antibody (DS5MMER), Super Bright 780, eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Flow

MERTK Monoclonal Antibody (DS5MMER), eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Western Blot, IF, ICC, IHC (F), Flow, IP

MERTK Monoclonal Antibody (DS5MMER), PE-Cyanine7, eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Flow

MERTK Monoclonal Antibody (DS5MMER), Super Bright 702, eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Flow

MERTK Monoclonal Antibody (HMER5DS), PE-Cyanine7, eBioscience™ (Invitrogen™)

MERTK Monoclonal Antibody for Flow

T3 promoter Sequencing Primer, 17-mer (Thermo Scientific™)

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T3 RNA Polymearse promoter region and are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments located downstream from the T3 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO119—T3 promoter sequencing primer, 17-mer 5'-d (ATTAACCCTCACTAAAG)-3'
• SO120—T3 promoter sequencing primer, 24-mer 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3'

Note
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
T3 promoter Sequencing Primer, 24-mer
T7 promoter Sequencing Primer, 20-mer
SP6 promoter Sequencing Primer, 18-mer
SP6 promoter Sequencing Primer, 24-mer

T3 promoter Sequencing Primer, 24-mer (Thermo Scientific™)

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T3 RNA Polymearse promoter region and are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments located downstream from the T3 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO119—T3 promoter sequencing primer, 17-mer 5'-d (ATTAACCCTCACTAAAG)-3'
• SO120—T3 promoter sequencing primer, 24-mer 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3'

Note
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
SP6 promoter Sequencing Primer, 18-mer
T3 promoter Sequencing Primer, 17-mer
SP6 promoter Sequencing Primer, 24-mer
T7 promoter Sequencing Primer, 20-mer

M13/pUC sequencing primer (-20), 17-mer (Thermo Scientific™)

Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

M13/pUC Reverse Sequencing Primer (-26), 17-mer (Thermo Scientific™)

Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

M13/pUC Sequencing Primer (-46), 22-mer (Thermo Scientific™)

Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

T7 promoter Sequencing Primer, 20-mer (Thermo Scientific™)

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments located downstream from the T7 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO118—T7 promoter sequencing primer, 20-mer 5'-d (TAATACGACTCACTATAGGG)-3'
Note
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
T3 promoter Sequencing Primer, 17-mer
SP6 promoter Sequencing Primer, 24-mer
T3 promoter Sequencing Primer, 24-mer
SP6 promoter Sequencing Primer, 18-mer

M13/pUC Sequencing Primer (-40), 17-mer (Thermo Scientific™)

Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

SP6 promoter Sequencing Primer, 24-mer (Thermo Scientific™)

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the SP6 RNA Polymerase promoter region and are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO116—SP6 promoter sequencing primer, 18-mer 5'-d (ATTTAGGTGACACTATAG)-3'
• SO117—SP6 promoter sequencing primer, 24-mer 5'-d (CATACGATTTAGGTGACACTATAG)-3'
Note
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
SP6 promoter Sequencing Primer, 18-mer
T7 promoter Sequencing Primer, 20-mer
T3 promoter Sequencing Primer, 17-mer
T3 promoter Sequencing Primer, 24-mer

pJET1.2 Reverse Sequencing Primer, 24-mer (Thermo Scientific™)

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2pJET1.2 sequence sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR

Catalog number and Primer sequence:
• SO501—pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• SO511—pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'

Related Products
pJET1.2 Forward Sequencing Primer, 23-mer

SP6 promoter Sequencing Primer, 18-mer (Thermo Scientific™)

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the SP6 RNA Polymerase promoter region and are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO116—SP6 promoter sequencing primer, 18-mer 5'-d (ATTTAGGTGACACTATAG)-3'
• SO117—SP6 promoter sequencing primer, 24-mer 5'-d (CATACGATTTAGGTGACACTATAG)-3'
Note
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
SP6 promoter Sequencing Primer, 24-mer
T7 promoter Sequencing Primer, 20-mer
T3 promoter Sequencing Primer, 17-mer
T3 promoter Sequencing Primer, 24-mer

pJET1.2 Forward Sequencing Primer, 23-mer (Thermo Scientific™)

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2pJET1.2 sequence sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR

Catalog number and Primer sequence:
• SO501—pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• SO511—pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'

Related Products
pJET1.2 Reverse Sequencing Primer, 24-mer

M13/pUC Reverse Sequencing Primer (-46), 24-mer (Thermo Scientific™)

Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

MERTK Polyclonal Antibody (Invitrogen™)

MERTK Polyclonal Antibody for Western Blot

Phospho-MER/SKY (Tyr749, Tyr681) Polyclonal Antibody (Invitrogen™)

Phospho-MER/SKY (Tyr749, Tyr681) Polyclonal Antibody for Western Blot

MERTK Polyclonal Antibody (Invitrogen™)

MERTK Polyclonal Antibody for Western Blot

MerTK/c-mer Polyclonal Antibody (Bethyl Laboratories)

MerTK/c-mer Polyclonal Antibody for Western Blot

MerTK/c-mer Polyclonal Antibody (Bethyl Laboratories)

MerTK/c-mer Polyclonal Antibody for Western Blot

MERTK Recombinant Rabbit Monoclonal Antibody (SR29-07) (Invitrogen™)

MERTK Recombinant Monoclonal Antibody for Western Blot, IHC

MERTK (cMER) [A708S] Recombinant Human Protein

MERTK (c-MER) is a member of the TYRO3/AXL/MER (TAM) receptor kinase family which encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Cytokine-dependent activation of TAM signaling diverts a proinflammatory pathway to provide an intrinsic feedback inhibitor of both TLR- and cytokine-driven immune responses. MERTK is essential regulators of mammalian spermatogenesis. Mutations in MERTK gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). Recombinant human MERTK A708S (578-872) was expressed by baculovirus in Sf9 insect cells using an N-terminal GST tag.

• Validated in LanthaScreen® Kinase Binding Assay
• Protocols available for simple use and optimized performance
• Multiple pack sizes available for convenient use

Related Product:
LanthaScreen® Eu Kinase Binding Assay

MERTK (cMER) Recombinant Human Protein

MERTK (cMER) is a tyrosine kinase proto-oncogene and is involved in the retinal pigment epithelium (RPE) phagocytosis pathway, which is implicated in human retinal disease.

MER (MerTK) Human ProcartaPlex™ Simplex Kit (Invitrogen™)

The Human MER Simplex ProcartaPlex kit measures MER protein and is designed to be combinable with other Simplex kits so that you can create your own multiplex panel that utilizes Luminex xMAP technology for protein detection/quantitation. When combining multiple Simplex kits (i.e., when you are not using a pre-configured Multiplex Panel), only one buffer kit (sold separately) is needed for each assay plate regardless of plex size.

ProcartaPlex immunoassays are based on the principles of a sandwich ELISA, using two highly specific antibodies binding to different epitopes of one protein to quantitate up to 80 protein targets simultaneously when using the FLEXMAP 3D or Luminex 200 instrument and up to 50 protein targets when using the MAGPIX instrument. ProcartaPlex assays require as little as 25 µL of plasma or serum, or 50 µL of cell culture supernatant, and just four hours to obtain analyzed results.

Flexible panels—design your own panels with Simplex kits to measure your own array of targets
More results per sample—measure up to 80 protein targets in a single 25–50 µL sample
Well-established Luminex technology—the most referenced multiplexing platform for protein detection and quantitation

The Luminex MagPlex superparamagnetic microsphere beads in the ProcartaPlex assay are internally dyed with precise proportions of red and infrared fluorophores to create 100 spectrally unique signatures that can be identified by the Luminex xMAP detec¬tion systems (Luminex 200, FLEXMAP 3D, and MAGPIX systems). Similar to a sandwich ELISA, the ProcartaPlex assay uses matched antibody pairs to identify the protein of interest. In a ProcartaPlex multiplex assay, each spectrally unique bead is labeled with antibodies specific for a single target protein, and bound proteins are identified with biotinylated antibodies and streptavidin–R-phycoerythrin (RPE). The conjugation of protein-specific antibodies to a distinct bead allows for analysis of multiple targets in a single well.

The most significant difference between a ProcartaPlex assay and ELISA is that the capture antibody in the ProcartaPlex assay is conjugated to a magnetic bead and not adsorbed to the microplate well, so the ProcartaPlex assay reagents are free-floating in the solution. For detection, the Luminex 200 instrument, for example, contains two lasers, one to distinguish the spectral signature of each bead and the second to quantify the amount of RPE fluorescence, which is proportional to the amount of protein present in the sample. ProcartaPlex multiplex assays can profile up to 80 times more target proteins using significantly less sample in the same time that it takes to perform a traditional sandwich ELISA.

ProcartaPlex Simplex kits provide the ability to create your own unique panel . More than 90% of ProcartaPlex Simplex targets can be combined, providing you with superior flexibility when creating your own multiplex panel.

ProcartaPlex Simplex kits are available across six species (human, mouse, rat, nonhuman primate, porcine, and canine). Visit thermofisher.com/procartaplex for more information, including a comprehensive list of individual protein targets.

Reactivity/species: human
Suitable sample types: cell culture supernatant, serum, plasma
Sample volume: serum, plasma: 25 µL; CCS: 50 µL
Reported application: multiplex immunoassay

MERTK Polyclonal Antibody (Invitrogen™)

MERTK Polyclonal Antibody for Western Blot, IF, ICC, IHC (P), Flow

MERTK Polyclonal Antibody (Invitrogen™)

MERTK Polyclonal Antibody for Western Blot, IHC (P)

MERTK Monoclonal Antibody (7E5G1) (Invitrogen™)

MERTK Monoclonal Antibody for Western Blot

Phospho-MER/SKY (Tyr749, Tyr681) Polyclonal Antibody (Invitrogen™)

Phospho-MER/SKY (Tyr749, Tyr681) Polyclonal Antibody for Western Blot, IHC (P)

MERTK Polyclonal Antibody (Invitrogen™)

MERTK Polyclonal Antibody for Western Blot, IF, ICC, IP

MERTK Polyclonal Antibody (Invitrogen™)

MERTK Polyclonal Antibody for Western Blot

MERTK Monoclonal Antibody (A311F9G3) (Invitrogen™)

MERTK Monoclonal Antibody for Western Blot

LanthaScreen™ Tb-PY20 Antibody Kit

A general reagent to monitor tyrosine kinase activity, the pY20 antibody binds to phosphorylated tyrosines within a peptide or physiological protein substrate.

For use in combination with Fluorescein-poly-GT (PV3610) or Fluorescein-poly-GAT (PV3611) to evaluate inhibitors in medium to high throughput screening applications.

AXL [R499C] Recombinant Human Protein

AXL, a transforming gene isolated from primary human myeloid leukemia cells, encodes a novel receptor tyrosine kinase which is a member of the TAM (TYRO3/AXL/MER) receptor tyrosine kinase subfamily. AXL represents a unique structure of the extracellular region that juxtaposes IgL and FNIII repeats and Axl transduces signals from the extracellular matrix into the cytoplasm by binding growth factors like vitamin K-dependent protein growth-arrest-specific gene 6. AXL is involved in the stimulation of cell proliferation and can also mediate cell aggregation by homophilic binding. Recombinant human AXL R499C (473-end) was expressed by baculovirus in Sf9 insect cells using an N-terminal GST tag.

• Validated in LanthaScreen® Kinase Binding Assay
• Protocols available for simple use and optimized performance
• Multiple pack sizes available for convenient use

Related Product:
LanthaScreen® Eu Kinase Binding Assay

Oligo(dT)12-18 Primer (Invitrogen™)

Oligo(dT)12-18 Primer is suitable for use in first-strand cDNA synthesis with reverse transcriptase. The primer hybridizes to the poly(A) tail of mRNA. It is phosphorylated on the 5´ end to facilitate cloning of cDNA.

Performance and Quality Testing:
Performance is evaluated in a first-strand cDNA synthesis reaction.

Apoptotic Cell Clearance 12-plex Human ProcartaPlex™ Panel (Invitrogen™)

The Human Apoptotic Cell Clearance 12-plex ProcartaPlex Panel is a preconfigured multiplex immunoassay kit that measures 12 protein targets using Luminex xMAP technology. ProcartaPlex preconfigured panels are supplied with all the necessary reagents to perform the assay and are validated to ensure reproducibility and consistency. These panels are designed for those who need greater validation for longitudinal studies.

ProcartaPlex immunoassays are based on the principles of a sandwich ELISA, using two highly specific antibodies binding to different epitopes of one protein to quantitate all protein targets simultaneously using a Luminex instrument. ProcartaPlex multiplex assays require as little as 25 µL of plasma or serum, or 50 µL of cell culture supernatant, and just four hours to obtain analyzed results.

Reproducible, reliable results—validated as a panel to the highest industry standard, including protein target combinability and cross-reactivity testing
More results per sample—measure multiple protein targets simultaneously in a single 25–50 µL sample
Well-established Luminex technology—the most referenced multiplexing platform for protein detection and quantitation

ProcartaPlex assays utilize Luminex xMAP (multianalyte profiling) technology for the simultaneous detection and quantitation of up to 80 protein targets in a single 25–50 µL sample—from plasma, serum, cell culture supernatants, and other bodily fluids.

The Luminex MagPlex superparamagnetic microsphere beads in the ProcartaPlex assay are internally dyed with precise proportions of red and infrared fluorophores to create 100 spectrally unique signatures that can be identified by the Luminex xMAP detec¬tion systems (Luminex 200, FLEXMAP 3D, and MAGPIX systems). Similar to a sandwich ELISA, the ProcartaPlex assay uses matched antibody pairs to identify the protein of interest. In a multiplexed assay, each spectrally unique bead is labeled with antibodies specific for a single target protein, and bound proteins are identified with biotinylated antibodies and streptavidin–R-phycoerythrin (RPE). The conjugation of protein-specific antibodies to a distinct bead allows for analysis of multiple targets in a single well.

The most significant difference between a ProcartaPlex assay and ELISA is that the capture antibody in the ProcartaPlex assay is conjugated to a magnetic bead and not adsorbed to the microplate well, so the ProcartaPlex assay reagents are free-floating in the solution. For detection, the Luminex 200 instrument, for example, contains two lasers, one to distinguish the spectral signature of each bead and the second to quantify the amount of RPE fluorescence, which is proportional to the amount of protein present in the sample. ProcartaPlex multiplex assays can profile more target proteins using significantly less sample in the same time that it takes to perform a traditional sandwich ELISA.

ProcartaPlex multiplex panels are available in multiple formats across six species (human, mouse, rat, nonhuman primate, porcine, and canine). Visit thermofisher.com/procartaplex for more information and available products.

Reactivity/species: human
Suitable sample types: cell culture supernatant, serum, plasma
Sample volume: serum, plasma: 25 µL; CCS: 50 µL
Reported application: multiplex immunoassay
Target list: MER (MERTK), AXL, TYRO-3, CD36, RAGE, Gas6, uPAR, CRT (CALR), LOX1, PAI1, CD31, MBL
Bead regions: MER (MERTK): 26; AXL: 27; TYRO-3: 37; CD36: 38; RAGE: 47; Gas6: 53; uPAR: 61; CRT: 73; LOX1: 76; PAI1: 35; CD31: 72; MBL: 55
Assay range (as determined for Lot 1): MER (MERTK): 171–174700; AXL: 244–1000000; TYRO-3: 24–50000; CD36: 436–1786000; RAGE: 2–1775; Gas6: 83–338500; uPAR: 53–215500; CRT: 764–3130900; LOX1: 1.2–5100; PAI1: 38.7–39650; CD31: 630–645450; MBL: 67.2–68775
Assay sensitivity (as determined for Lot 1): MER (MERTK): 121.2; AXL: 241.8; TYRO-3: 13.1; CD36: 136.7; RAGE: 0.8; Gas6: 45.4; uPAR: 49.7; CRT: 309.8; LOX1: 0.7; PAI1: 2.4; CD31; 162.5; MBL: 52.8

Fluorescein-Poly GAT

A general fluorescein peptide substrate consisting of a polymer of glutamate, alanine, and tyrosine that is used to monitor tyrosine kinase activity.

For use in combination with the LanthaScreen® Tb-pY20 Antibody (PV3552) to evaluate inhibitors in medium to high throughput screening applications.

Oligo(dT)20 Primer (Invitrogen™)

Used for first-strand cDNA synthesis with reverse transcriptase at temperatures of >=50°C, oligo(dT)20 primer is a string of 20 deoxythymidylic acid residues that hybridizes to the poly(A) tail of mRNA. Oligo(dT)20 is recommended for use with SuperScript® III Reverse Transcriptase, ThermoScript™ Reverse Transcriptase, or Cloned AMV Reverse Transcriptase.

Quality Control:
This product is qualified in a first-strand cDNA synthesis reaction.

Oligo d(T)16 (50 µM) (Invitrogen™)

Invitrogen® Oligo d(T)16 is a homo-oligomeric deoxyribonucleotide (poly dT) that is non-phosphorylated and chemically synthesized. It is used for priming and reverse transcription of polyadenylated (poly A+) mRNA. Five nmoles of primer is supplied at a concentration of 50 µM.

Fluorescein-Poly GT

A general fluorescein peptide substrate consisting of a polymer of glutamate, and tyrosine that is used to monitor tyrosine kinase activity.

For use in combination with the LanthaScreen® Tb-pY20 Antibody (PV3552) to evaluate inhibitors in medium to high throughput screening applications.

Random Hexamer Primer (Thermo Scientific™)

Thermo Scientific Random Hexamer Primer is a mixture of single-stranded random hexanucleotides with 5'- and 3'-hydroxyl ends. The primer is supplied as a ready-to-use, 20X concentrated aqueous solution (24 µg at 100 µM concentration).

Applications

• cDNA Synthesis
• RT-qPCR
• RT-PCR

Related Products
Oligo(dT)18 Primer
Anchored Oligo dT

GPR30 Polyclonal Antibody (Invitrogen™)

GPR30 Polyclonal Antibody for Western Blot, IF, IHC (P)

ERH Polyclonal Antibody (Invitrogen™)

ERH Polyclonal Antibody for Western Blot, IHC (P)

GPR30 Polyclonal Antibody (Invitrogen™)

GPR30 Polyclonal Antibody for IHC (P), ELISA