Search
Search
View additional product information for GeneArt™ Service Plasmid Sequence Verification - FAQs (882022DE)
20 product FAQs found
The kit and custom services offer different advantages. Please click here (http://www.thermofisher.com/us/en/home/life-science/cloning/gene-synthesis/geneart-gene-synthesis-product-selection-guide.html) to view a selection guide comparing the technologies, including deliverables and production time, to determine what is best for you.
Our proprietary GeneOptimizer software (https://www.thermofisher.com/us/en/home/life-science/cloning/gene-synthesis/geneart-gene-synthesis/geneoptimizer.html) calculates the optimal DNA sequence needed to encode the protein of interest (gene optimization). Adapting the codon usage of the gene to the codon preferences of the expression organism (codon optimization) is just one of the parameters addressed. The GeneOptimizer software currently evaluates several additional parameters that can compromise mRNA stability, such as extreme GC content, ribosomal binding sites, consensus and cryptic splice sites, repeats, and secondary structures. Increased numbers of stable mRNA molecules often lead to higher yields of protein.
GeneArt Gene Synthesis Service includes gene optimization (if requested), synthesis of the DNA, cloning into our standard vector, and delivery of 5 µg of lyophilized DNA plus a compact disc containing the in silico analysis and quality control information.
Yes. We can subclone your gene into a vector you provide. You will receive 5 µg each of your gene in a GeneArt cloning vector and in your vector (plus the quality control information for both constructs).
Unfortunately, this vector does not contain expression elements such as a promoter or terminator for proper protein expression. We recommend subcloning your synthetic gene into an expression vector of your choice via restriction enzyme cloning, or we can perform this for you as a custom service.
Yes, you can protect specified regions or restriction enzymes sites that you would not like to be optimized by the the GeneOptimizer process. In the portal, under "Optimize sequence", choose "Protect Restriction Sites" and/or "Protect Sequence Parts" from optimization.
ColE1 is the ori.
Due to our production process, this is not an option we can offer to you. Restriction enzymes are added that generally eliminate most of the standard vectors' multiple cloning site.
Genes are typically cloned into one of our GeneArt pMx standard vectors. These vectors contain
• a multiple cloning site
• an Ori (colE1)
• an antibiotic resistance marker (ampicillin, kanamycin, streptomycin, chloramphenicol); please note standard orders do not guarantee any specific standard vector
There are multiple factors to be considered: CG content, repetition score, direct repeats, and secondary structures, as well the assigned host organism and total length of the gene. All of these things are taken into consideration when deciding whether or not a gene or a part of a sequence is ‘complex'.
The Superspeed delivery option is only available for non-complex genes, up to 3 kb in size. If your gene does not fit these requirements, the option will be greyed out.
Single variants and variant bundles (more than one variant process) are variants of a master gene. The variant criteria are as follows:
Variants may contain up to four of the following modifications:
- 5'/3' deletion of any length with additional 52 nt of new sequence on each side
- 5'/3' modification of a maximum of 52 nt on each side
- 5'/3' extension of a maximum of 52 nt on each side
- Internal modifications of up to 40 nt (a maximum of 3 of these internal modification blocks are allowed)
- Internal deletions of any length
- Modifications (whether internal or 5´/3´) must be separated by at least 100 bp.
If a gene falls outside of these criteria, it must be created as a separate gene synthesis instead of as a variant.
Currently, we do not offer this as a service. Subcloning can be achieved using a restriction enzyme–based vector or via BP/LR clonase reactions into a Gateway vector. Alternatively, the GeneArt Strings DNA Fragments we offer can be directly cloned into a TOPO Zero Blunt vector.
You will receive 5µg lyophilized plasmid (synthesized gene cloned into pMx plasmid), unless otherwise requested. Upon reciept, the DNA can be re-suspended and stored in aliquots at –20 degrees C. You will also receive a CD with sequencing alignment data along with your DNA.
The sizes vary slightly due to the size of the anitibiotic resistance marker. pMA:2.5kb, pMS: 2.6kb, pMC: 2.3kb, pMK: 2.4kb.
The GeneOptimizer process takes a multi-parameter approach to analyze the gene sequence. It will take codon usage, GC content, cryptic splice sites, direct repeats, RNA secondary structures, and instability sequences into account when optimizing a gene sequence.
In theory, no there is no limit. However, very large DNA fragments (greater than 10 kb) need to be cloned into a low-copy vector to ensure genetic stability. Therefore, increasing length leads to increased production time.
We offer a GeneArt Strings DNA Fragments service, which provides custom-made linear, double-stranded DNA fragments up to 1,000 bp in length. Go to www.thermofisher.com, and search for "GeneArt Strings DNA Fragments" to learn more about this product.
Yes, all pMX vectors contain an M13-20 primer binding site and a M13-R primer binding site. The sequences are as follows:
M13-20 forward primer binding site: 5' - TTGTAAAACGACGGCCAG - 3'br/>
M13-R primer binding site: 5' - GGAAACAGCTATGACCATGT - 3'
pMx is the standard GeneArt cloning vector used to clone in your synthetic gene of interest. The “x” stands for the antibiotic of choice. Therefore, pMA stands for ampicillin, pMK stands for kanamycin, pMS stands for spectinomycin, pMC stands for chloramphenicol, and pMZ stands for Zeocin antibiotic. All vectors contain a multiple cloning site, an ORI (colE1), and an antibiotic resistance marker, along with M13-20/M13-R primer binding sites for sequencing.