CTS StemPro HSC Expansion Medium

Most HSC media systems expand progenitor cells at the expense of more primitive stem cells that are critical for stem cell function and long-term engraftment. That’s why we developed CTS StemPro HSC Expansion Medium—to provide you with more functional hematopoietic stem cells for your cell and gene therapy applications.

CTS StemPro HSC Expansion Medium:

  • cGMP manufactured and designed for cell and gene therapy applications
  • Facilitates engraftment of expanded CD34+ cells in animal transplant models
  • Offers superior expansion of the total CD34+ cell population and enrichment of the CD34+CD90+CD45RA subset

Facilitates engraftment in animal transplant models

CD34+ cells expanded with CTS StemPro HSC Expansion Medium demonstrate long-term engraftment potential and exhibit multilineage chimerism at 6 months post-transplant (Figure 1).


Figure 1. Non-cultured cells or ex vivo–cultured cells were transplanted into 6- to 8-week-old NRG mice. Mice were sacrificed 6 months (24 weeks) after transplantation and the bone marrow and spleen cells were analyzed for human cell engraftment. For ex vivo expansion, one human, single-donor purified CD34+ mobilized peripheral blood sample was cultured for 7 days in CTS StemPro HSC Expansion Medium (CTS StemPro HSC Basal and 50X Supplement) supplemented with SCF, Flt3L, TPO, IL3, and IL6 cytokines. Twenty-four weeks after transplant, bone marrow and spleen were harvested, and single cells isolated. Cells were stained with antibodies and immunophenotyped using an Attune NxT Flow Cytometer. Error bars denote standard error. Data was normalized to equivalent cell dosage of uncultured cells and ex vivo-cultured cells.

Enables genetic modification via CRISPR-Cas9

CTS StemPro HSC Expansion Medium enables CRISPR-Cas9 gene editing of CD34+ cells via the Neon electroporation device (Figure 2).


Figure 2. The donor DNA was prepared by PCR which contained a promoterless puro_2A_EmGFP cassette flanked by 35nt homology arm on each side. The gRNA targeting the n-terminus of ACTB locus (GCGGCGATATCATCATCCATGG) was synthesized. Single donor, mobilized peripheral blood CD34+ cells were thawed and cultured in CTS StemPro HSC Expansion Medium containing SCF, FLT3, TPO, IL3 and IL6 growth factors.
Transfection efficiency: for Neon electroporation, cells were washed then re-suspended in Resuspension Buffer R. To form the RNP (ribonucleoprotein) complexes, 1.2 µg TrueCut Cas9 Protein v2 and 300 ng gRNA was added to Resuspension Buffer R. Donor DNA and the cell suspension was added to the RNP complexes and then used for electroporation.
CD34+CD90+ cells in GFP+/ cells+/–: the efficiency of in-frame insertion of a promoterless puro_2A_EmGFP fragment into the n-terminus of ACTB locus was measured by Attune NxT Flow Cytometer at 72 hours post transfection. The percentages of EmGFP-positive cells, CD34-positive cells, and CD90-positive cells were also determined using the Attune NxT Flow Cytometer. The EmGFP-positive cells were further sorted from transfected cells using the S3e cell sorter (Bio-Rad).
In vitro colony forming assay: EmGFP-negative and EmGFP-positive cells were plated onto MethoCult medium at a cell density of 500 cells/ml medium in a 6-well plate. Upon incubation at 37°C, in 5% CO2, with ≥ 95% humidity for approximately 14 days, the number of white (granulocyte and macrophage progenitors) and red blood cell (erythroid progenitors) colonies were counted under the microscope.

Enables Lentivirus Transduction of CD34+ Cells

CTS StemPro HSC medium enables lentiviral transduction of CD34+ cells with lentiviral vector generated using Gibco CTS LV-MAX system.


Figure 3. CTS StemPro HSC Enables Lentiviral transduction of CD34+ cells. Single donor, mobilized peripheral blood derived, CD34+ cells were thawed and pre-stimulated in CTS StemPro HSC containing SCF, Flt3L, TPO, IL3, and IL6 for 48 hours. Cells were transduced for another 48 hours with CTS LV-MAX generated GFP virus an MOI of 2, 5, 10 and 20 in Retronectin coated plates (5 μg/cm2), and spinoculation performed at 600 x g for 1 hour at 30C. Another 48 hours after transduction, cells were washed to remove virus and cultured with CTS StemPro HSC Expansion Medium containing cytokines. Efficiency of transduction was evaluated by flow cytometry at 48 hours, 72 hours and 120 hours by staining with CD34 and CD90 antibodies and analyzed using an Attune NxT Flow Cytometer. Percent viability was performed using the Invitrogen Countess II Automated Cell Counter.

Enables higher reprogramming efficiency

CTS StemPro HSC Expansion Medium enables xeno-free reprogramming of PBMC into iPSC with CTS CytoTune-iPS 2.1 and CytoTune 2.0-iPS Sendai reprogramming kits (Figure 4).


Figure 4. Three single PBMC donors were thawed and cultured in either StemPro34 containing SCF, IL3, and GM-CSF; or CTS StemPro HSC medium containing SCF, Flt3L, TPO, IL3, and IL6. During each day of culture, half the media was removed and replaced with fresh media containing cytokines. Four days later, (Day 0) PBMC were transduced with CTS CytoTune 2.1-iPS Sendai Reprogramming Kit at an MOI of 5-5-3 (KOS-LMyc-Klf4) in the presence of polybrene, and cultured under hypoxic (5% O2) or standard normoxic conditions. Three days later, cells were plated onto LN521 coated plates containing no cytokines. Eight days after transduction, half the media was removed and replaced with Essential 8 Medium. The following day, and every day thereafter, cells were fed with Essential 8 Medium. Sixteen days after transduction, reprogramming efficiency was determined by staining cells for alkaline phosphatase using the Red Alkaline Phosphatase (Red AP) Substrate Kit (Vector Laboratories). The number of AP positive colonies was counted, and reprogramming efficiency was determined relative to the number of cells plated on Day 3 after transduction. Values reported are the mean of three donors.

Superior expansion and enrichment

CTS StemPro HSC Expansion Medium not only enables superior expansion of the total CD34+ cell population, but also enriches for the CD34+CD90+CD45RA subset, providing the researcher more cells to work with (Figures 5–6).


Figure 5. Purified CD34+ cells from human mobilized peripheral blood (mPB) were cultured in CTS StemPro HSC Expansion Medium (CTS StemPro HSC Basal and 50X Supplement) containing SCF, Flt3L, TPO, IL3, and IL6. Cells were cultured for 7 days, then assessed by flow cytometry using Attune NxT Flow Cytometer for expression CD34, CD90, and CD45RA. Doublets and dead cells were excluded from analysis, and gates identifying CD34+ cells and CD90+CD45RA cells were demarcated based on fluorescent minus one (FMO) controls.

Lot-to-lot consistency

CTS StemPro HSC Expansion Medium demonstrates consistent lot-to-lot performance in the expansion of CD34+ mPBs.


Figure 6. CD34+ mPB samples expanded in three lots of CTS StemPro HSC Expansion Medium demonstrate consistent levels of CD34+ cell expansion for each lot. Three human single donor purified CD34+ mPB samples were cultured in three lots of CTS StemPro HSC Expansion Medium (CTS StemPro HSC Basal and 50X Supplement), all supplemented with SCF, Flt3L, TPO, IL3, and IL6 cytokines. Cells were cultured for 7 days, following which total nucleated cells (TNC) and % viability were determined using a Countess II automated cell counter and phenotype assessed using an Attune NxT Flow Cytometer. Error bars denote standard deviation.

Supports megakaryocyte and erythrocyte progenitor cell expansion

CTS StemPro HSC Expansion Medium helps support up to ~2,500-fold increase in megakaryocyte and erythroid progenitor cells.


Figure 8. One human, single-donor purified CD34+ mobilized peripheral blood sample was cultured for 7 days in CTS StemPro HSC Expansion Medium (CTS StemPro HSC Basal and 50X Supplement) supplemented with SCF, Flt3L, TPO, IL3, and IL6 cytokines. Cells were cultured for 7 days. Following which total nucleated cells (TNC) and % viability were determined using a Countess II automated cell counter. Immunophenotype was assessed for CD34, CD71 and CD71 using an Attune NxT Flow Cytometer.

Invitrogen Dynabeads CD34 Positive Isolation Kit

Dynabeads CD34 Positive Isolation Kit

Use this kit to isolate a high purity and yield of human CD34+ progenitor stem cells. Positively isolated cells are bead and antibody-free, phenotypically unaltered and suitable for any downstream applications including flow cytometry, functional studies, and cell culture to produce dendritic cells (DC's).

  • Positive isolation of human CD34+ progenitor stem cells with bead release
  • Stem cells can be isolated directly from whole blood, cord blood or bone marrow
  • Isolated CD34+ cells can be used in any application, e.g., be derived into dendritic cells (DCs)

Order Dynabeads CD34 Positive Isolation Kit

Ordering information for CTS StemPro HSC Expansion Media and components

CTS StemPro HSC Expansion Medium consists of a liquid basal medium and frozen supplement, which is added at the time of use. The media does not contain growth factors or cytokines.

Invitrogen antibodies and LIVE/DEAD stain kits


1. What is CTS StemPro HSC Expansion Medium?

  • CTS StemPro HSC Expansion Medium is a completely new xeno-free serum-free formulation which consists of a 50X supplement and phenol red-free basal medium, and does not require additional cell culture supplements (e.g., L-glutamine, GlutaMAX, amino acids or serum).  Before use in culture, cytokines or growth factors should be added to the complete medium.
  • CTS StemPro HSC Expansion Medium can be used for:
    • Expansion of CD34+ cells.
    • Differentiation of CD34+ cells into cell types such as granulocytes, megakaryocytes, and erythrocytes.
    • Reprogramming of CD34+ cells into iPSC cells (using CytoTune 2.0 or CytoTune 2.1).
    • Reprogramming PBMC into iPSC cells (using CytoTune 2.0 or CytoTune 2).
    • CRISPR-Cas9 Gene Editing (using Neon Transfection System).

2. What components do I receive with CTS StemPro HSC Expansion Medium?

3. How should I store CTS StemPro HSC Expansion Medium?

  • The CTS StemPro HSC Basal Medium should be stored at 2°C to 8°C, protected from light.
  • The CTS StemPro HSC Supplement (50X) should be stored at -20°C, protected from light.

4. What is the stability of CTS StemPro HSC Expansion Medium?

  • The CTS StemPro HSC Basal Medium when stored at 2°C to 8°C, protected from light is stable for 12 months.
  • The CTS StemPro HSC Supplement (50X) when stored at -20°C, protected from light is stable for 12 months.

5. Is CTS StemPro HSC Expansion Medium animal origin-free (AOF) or xeno-free (XF)?

  • The formulation of CTS StemPro HSC Expansion Medium contains components of human, recombinant or synthetic origin, therefore the media system is xeno-free (XF) but not animal origin-free (AOF).

6. Can I order the CTS StemPro HSC Basal Medium and CTS StemPro HSC Supplement (50X) separately?

  • No, these components can only be purchased together as this media system has been optimized to work together for maximal performance.

7. How do I thaw and mix CTS StemPro HSC Supplement (50X)?

  • CTS StemPro HSC Supplement (50X) can be thawed at room temperature (RT) for ~1.5 hours or at 4°C overnight.  Do NOT thaw the frozen supplement at 37°C.  Once completely thawed the supplement should be allowed to equilibrate to RT for at least 30 minutes, but not longer than 3 hours, before gently mixing the supplement by inverting the vial 10 times until supplement is completely homogenous.

8. Can I thaw CTS StemPro HSC Supplement (50X) in a 37°C water bath or incubator?

  • No. CTS StemPro HSC Supplement (50X) should be thawed at room temperature (RT) for ~1.5 hours or at 4°C overnight. Allow supplement to equilibrate to RT before mixing and preparing single-use aliquots to re-freeze or preparing complete medium.
  • Failure to properly thaw CTS StemPro HSC Supplement may result in the formation of precipitates.

9. Can I re-freeze CTS StemPro HSC Supplement (50X) into smaller aliquots for future use?

  • Yes. Once the CTS StemPro HSC Supplement (50X) is thawed and mixed until completely homogenous, single-use aliquots can be prepared and re-frozen at -20°C. Avoid multiple freeze-thaw cycles.

10. How do I prepare the 1X complete CTS StemPro HSC Expansion Medium?

  • Ensure that both thawed Supplement and Basal are at room temperature prior to mixing together to generate the 1X complete CTS StemPro HSC Medium.
  • Failure to have the Supplement and Basal Medium at room temperature prior to mixing for 1X medium may result in the formation of precipitates.
  • To make 100 mL of complete medium, aseptically add 2 mL of thawed and mixed CTS StemPro HSC Supplement (50X) to 98 mL CTS StemPro HSC Basal Medium and invert gently.  Best results are observed when the complete medium is used the same day.  Immediately prior to use in culture, add desired cytokines or growth factors.
  • For hematopoietic stem cell culture, we recommend adding the following cytokines at the final concentration indicated: SCF (100 ng/mL), FLT-3L (100 ng/mL), TPO (100 ng/mL), IL-3 (50 ng/mL), and IL-6 (20 ng/mL).

11. Can 1X complete CTS StemPro HSC Expansion Medium be frozen to extend product shelf life?

  • No, 1X complete CTS StemPro HSC Expansion Medium should not be frozen; best results are observed when the complete medium is prepared on the day it will be used.

12. Can CTS StemPro HSC Basal Medium be frozen to extend product shelf life?

  • No, CTS StemPro HSC Basal Medium should be stored at 2°C to 8°C, protected from light.  Best results are observed when the complete medium is prepared on the day it will be used.

13. Can I warm 1X complete CTS StemPro HSC Expansion Medium in a 37°C water bath or incubator?

  • No, before use equilibrate complete medium required for that day at room temperature until it is no longer cool to the touch.

14. How long is the 1X complete CTS StemPro HSC Expansion Medium stable for after preparation?

  • 1X complete CTS StemPro HSC Expansion Medium is stable for 1 week when stored at 2°C to 8°C.
  • Prior to use, equilibrate 1X complete CTS StemPro HSC Expansion Medium to room temperature.
  • Best results are observed when 1X complete CTS StemPro HSC Expansion Medium is prepared on the day it will be used.

15.    How long is the CTS StemPro Supplement 50X stable for after thaw?

  • CTS StemPro HSC Supplement 50X is stable for 1 week when stored at 2°C to 8°C.
  • Best results are observed when 1X complete CTS StemPro HSC Supplement 50X is thawed on the day it will be used.

16. Can I add CTS StemPro HSC Supplement (50X) to a different basal medium?

  • No, CTS StemPro HSC Supplement (50X) and CTS StemPro HSC Basal Medium should be used together as this media system has been optimized for maximal performance.

17. Does the CTS StemPro HSC basal medium or CTS StemPro HSC Supplement (50X) contain cytokines or growth factors?

  • No, the media system is formulated without cytokines or growth factors, but cytokines and/or growth factors should be added immediately prior to use. For hematopoietic stem cell culture, we recommend adding the following cytokines at the final concentration indicated: SCF (100 ng/mL), FLT-3L (100 ng/mL), TPO (100 ng/mL), IL-3 (50 ng/mL), and IL-6 (20 ng/mL).

18. What cytokines or growth factors should I use with the CTS StemPro HSC Expansion Medium?

  • For hematopoietic stem and progenitor cell culture, we recommend adding the following cytokines at the final concentration indicated: SCF (100 ng/mL), FLT-3L (100 ng/mL), TPO (100 ng/mL), IL-3 (50 ng/mL), and IL-6 (20 ng/mL).
  • Cytokines or growth factors should be optimized for the researcher’s specific application.

19. Can I use CTS StemPro HSC Expansion Medium without cytokines or growth factors?

  • No, for hematopoietic stem and progenitor cell culture, we recommend adding the following cytokines at the final concentration indicated: SCF (100 ng/mL), FLT-3L (100 ng/mL), TPO (100 ng/mL), IL-3 (50 ng/mL), and IL-6 (20 ng/mL).

20. How long does 1X complete CTS StemPro HSC Expansion Medium last after addition of cytokines or growth factors?

  • Best results are observed when 1X complete CTS StemPro HSC medium is prepared and cytokines or growth factors are added on the day it will be used.
  • Depending on the duration of culture and seeding density, refeeding with fresh complete CTS StemPro HSC medium with growth factors is recommended.

21. Do I have to add serum (e.g., FBS, human serum, HSA, etc.) to 1X complete CTS StemPro HSC Expansion Medium before use?

  • No, the CTS StemPro HSC Expansion Medium system is designed to be used without serum supplementation.

22. The User Guide suggests culturing CD34+ cells in 1X complete CTS StemPro HSC Expansion Medium for 7 days, can I culture HSPCs for a shorter or longer period of time?

  • Yes. We recommend 7 day culture as we have found very good expansion of CD34+ cells can be achieved in 7 days for mobilized peripheral blood, cord blood and bone marrow.  Shorter or longer culture periods may need to be optimized for a given cell type and application.

23. Do I need to feed my cells or change the medium during a 7 day culture?

  •  We have found that it is unnecessary to feed cells or change media over a 7 day culture of mobilized peripheral blood CD34+ cells that were initially seeded at 5e3 cells/mL to 2e4 cells/mL.  Culture and feeding schedule may need to be optimized for higher seeding densities and/or different types of CD34+ cells.

24. What cell types has CTS StemPro HSC Expansion Medium been tested with?

  • CTS StemPro HSC Expansion Medium has been shown to expand healthy human CD34+ cells from cord blood, bone marrow and mobilized peripheral blood from single and pooled donors. Reprogramming of PBMC into iPSC has also been shown.

25. What cryomedium is recommended for cryopreservation of expanded HSPCs?

  • CTS PSC Cryomedium

26. Can CTS StemPro HSC Expansion Medium be used to culture mouse HSCs?

  • CTS StemPro HSC Expansion Medium has not been evaluated for culture of mouse HSCs.

27. What markers should I use to evaluate the phenotype of my HSPCs?


  • Cell Therapy Learning Center
    This collection of resources will help you gain a better understanding of cell therapy research
  •  Cell Therapy Brochure
    Learn about our solutions to help you achieve your cell therapy goals from research to commercialization
  •  CTS Brochure
    Learn more about our Cell Therapy Systems product offerings with our CTS brochure
  • Selection Guide
    Get help choosing cell therapy products for your cell type


Related Products

Intended use of the products mentioned on this page vary. For specific intended use statements please refer to the product label.