Search
Search
View additional product information for ViraPower™ II Lentiviral Gateway™ Expression System - FAQs (K36720)
85 product FAQs found
In the single-step protocol for the BP/LR Clonase reaction, we would not recommend substituting the BP Clonase II/LR Clonase II enzymes with BP Clonase /LR Clonase enzymes as this would result in very low recombination efficiency.
Yes, we have come up with a single-step protocol for BP/LR Clonase reaction (http://www.thermofisher.com/us/en/home/life-science/cloning/gateway-cloning.html#1), where DNA fragments can be cloned into Destination vectors in a single step reaction, allowing you to save time and money.
We would recommend performing a BP reaction with a Donor vector in order to obtain an entry clone. This entry clone can then be used in an LR reaction with the Destination vector to obtain the new expression clone.
We do not offer the 5X LR Clonase buffer and 5X BP Clonase buffer as standalone products. They are available as part of the enzyme kits.
We do not offer any Gateway vectors for expression in plants.
Possible causes include:
- large volume of viral supernatant used for transduction
- cells sensitive to Polybrene regaent
- too much antibiotic used for selection
- antibiotic used too soon after tranduction
- gene of interest is toxic to cells
Poor expression could result from low transduction efficiency, too low of a MOI, too much antibiotic used for selection, usage of antibiotic too soon after transduction, harveting cells too soon after transduction, having a gene of interest that is toxic to cells, or rerrangement in the LTR regions of the expression construct plasmid DNA.
Here are some possible causes and solutions:
- Promoter silencing; CMV promoter is prone to silencing especially in mouse and rat cells, screen multiple antibiotic resistant clones and select the one with the highest expression levels
- Viral stocks stored incorrectly; aliquot and store at -80 degrees C, do not freeze/thaw more than 3 times
Here are some possible causes and solutions:
- Too little antibotic used for selection
- Selection performed on confluent cells; replate cells
- Viral supernatant not diluted sufficiently; titer lentivus using a wider range of 10-fold serial dilutions
Possible causes include:
- low transfection efficiency; Use a high-quality plasmid prep, 293FT cells under passage 16, ensure removal of Geneticin during transfection, ensure correct DNA:lipid ratio, and that cells are plated at the correct confluency
- transfected cells are not cultured in medium containing sodium pyruvate; this reagent provides an extra energy source for cells
- viral supernatant harvested too early; viral supernatants can generally be collected 48-72 hrs post-transfection
- viral supernatant too dilute; concentrate virus using CsCl purification
- viral supernatant frozen and thawed multiple times; 3 times should be the maximum freeze/thaw
- gene of interest is large; viral titers decrease as size of insert increases, inserts larger than 5.6 kb are not recommended
- rearrangement in the LTR region of the epxression construct plasmid DNA; use Stb3 cells for transformatin of the lentiviral construct
- poor choice of titering cell line; use HT1080 cells or similar cell line
- Polybrene reagent is not included during transduction; transduce lentiviral construct into cells in the presence of Polybrene reagent
- Lipofectamine reagent handled incorrectly; ensure proper storage and mix gently before use
- Use fluorescence micrscopy to check titer with HiPerform FastTiter lentivirus
Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.
If 293FT cells detach shortly after transfection (4 hours to overnight):
- This may be a sign of Lipofectamine 2000 toxicity. Cells may have been plated too sparsely prior to transfections.
- The cells may not have been handled gently enough (these cells have a tendency to lift off easily).
- The cells may have been kept at room temperature for too long.
If cells detach 48 to 72 hours post-transfection:
- If the cells lift off in large sheets, this may be a sign of lentivirus production.
Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.
The DNA yield from lentiviral mini-prep DNA is often very low due to the presence of the LTRs in the vector backbone. Hence, we do not recommend using a mini-prep kit for propagation of lentiviral constructs. We recommend preparing lentiviral plasmid DNA using the S.N.A.P. MidiPrep Kit (Cat. No. K191001) or the PureLink HiPure Plasmid Midiprep Kit (Cat. No. K210004), both of which contain 10 mM EDTA in the Resuspension Buffer. Since lentiviral DNA midi-preps also often have low DNA yields, we recommend following specific protocols to increase yield- basically, grow cells slowly, use fewer cells per column, and use 100 mL lentivirus culture for each DNA midi-prep.
Note: If you are going to be mini-prepping the lentiviral plasmid during the cloning/colony screening processes, we recommend using the PureLink HQ Mini Kit (Cat. No. K210001) and following the manual protocol with one change: only a single elution with 50 mL TE, pH 8.0 buffer. The typical yield with this method is normally pretty low, 100-150 ng/mL (i.e., 5-7 mg total). The OD 260/280 is typically between 1.8 and 2.1.
We strongly recommend using Stbl3 E. coli for cloning lentiviral constructs. Stbl3 E. coli cells contain the recA13 mutation in their genotype that helps to minimize the likelihood of unwanted recombination between the LTRs. After transforming into Stbl3 E. coli, we recommend picking colonies and validating the lentivirus DNA from mini-preps using Afl II and Xho I digests before proceeding to midi-preps. In all of our lentiviral vectors, Afl II sites are present in both 5' and 3' LTRs, and a Xho I site is present after the 3' end of the MCS. Assuming Afl II cuts only in the LTR sites, and there are no Afl II or Xho I sites in the insert, 3 DNA fragments are expected to be generated from the Afl II + Xho I digest. Any unexpected DNA fragments can be assumed to be a result of LTR recombination. Only clones with the expected pattern of DNA fragments should be chosen for the subsequent midi-prep.
The ViraPower Lentiviral Expression System includes the following features designed to enhance its biosafety:
The pLenti expression vector contains a deletion in the 3' LTR (deltaU3) that does not affect the generation of the viral genome in the producer cell line, but results in self-inactivation of the lentivirus after transduction of the target cell (References: Yee JK, Moores JC, Jolly DJ, Wolff JA, Respess JG, Friedmann T (1987) Gene Expression from Transcriptionally Disabled Retroviral Vectors. Proc. Natl. Acad. Sci. USA 84: 5197-5201; Yu SF, Ruden Tv, Kantoff PW, Garber C, Seiberg M, Ruther U, Anderson WF, Wagner EF, Gilboa E (1986) Self-Inactivating Retroviral Vectors Designed for Transfer of Whole Genes into Mammalian Cells. Proc. Natl. Acad. Sci. USA 83: 3194-3198; Zufferey R, Dull T, Mandel RJ, Bukovsky A, Quiroz D, Naldini L, Trono D (1998) Selfinactivating Lentivirus Vector for Safe and Efficient in vivo Gene Delivery. J. Virol. 72: 9873-9880). Once integrated into the transduced target cell, the lentiviral genome is no longer capable of producing packageable viral genome.
- The number of genes from HIV-1 used in the system has been reduced to three (i.e., gag, pol, and rev).
- The VSV-G gene from Vesicular Stomatitis Virus is used in place of the HIV-1 envelope (References: Burns JC, Friedmann T, Driever W, Burrascano M, Yee JK (1993) Vesicular Stomatitis Virus G Glycoprotein Pseudotyped Retroviral Vectors: Concentration to a Very High Titer and Efficient Gene Transfer into Mammalian and Nonmammalian Cells. Proc. Natl. Acad. Sci. USA 90: 8033-8037; Emi N, Friedmann T, Yee JK (1991) Pseudotype Formation of Murine Leukemia Virus with the G Protein of Vesicular Stomatitis Virus. J. Virol. 65: 1202-1207; Yee JK, Miyanohara A, LaPorte P, Bouic K, Burns JC, Friedmann T (1994) A General Method for the Generation of High-Titer, Pantropic Retroviral Vectors: Highly Efficient Infection of Primary Hepatocytes. Proc. Natl. Acad. Sci. USA 91: 9564-9568).
- Genes encoding the structural and other components required for packaging the viral genome are separated onto four plasmids. All four plasmids have been engineered not to contain any regions of homology with each other to prevent undesirable recombination events that could lead to the generation of a replication-competent virus (Reference: Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, Naldini L (1998) A Third-Generation Lentivirus Vector with a Conditional Packaging System. J. Virol. 72: 8463-8471).
- Although the three packaging plasmids allow in trans expression of proteins required to produce viral progeny (e.g., gal, pol, rev, env) in the 293FT producer cell line, none of them contain LTRs or the psi packaging sequence. This means that none of the HIV-1 structural genes are actually present in the packaged viral genome, and thus, are never expressed in the transduced target cell. No new replication-competent virus can be produced.
- The lentiviral particles produced in this system are replication-incompetent and only carry the gene of interest. No other viral species are produced.'
- Expression of the gag and pol genes from pLP1 has been rendered Rev-dependent by virtue of the HIV-1 RRE in the gag/pol mRNA transcript. Addition of the RRE prevents gag and pol expression in the absence of Rev (Reference: Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, Naldini L (1998) A Third-Generation Lentivirus Vector with a Conditional Packaging System. J. Virol. 72: 8463-8471).
- A constitutive promoter (RSV promoter) has been placed upstream of the 5' LTR in the pLenti expression vector to offset the requirement for Tat in the efficient production of viral RNA (Reference: Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, Naldini L (1998) A Third-Generation Lentivirus Vector with a Conditional Packaging System. J. Virol. 72: 8463-8471).
Despite the presence of the above safety features, the lentivirus produced can still pose some biohazardous risk, since it can transduce primary human cells. For this reason, we highly recommend that you treat lentiviral stocks generated using this system as Biosafety Level 2 (BL-2) organisms and strictly follow all published guidelines for BL-2. Furthermore, exercise extra caution when creating lentivirus carrying potential harmful or toxic genes (e.g., activated oncogenes).
For more information about the BL-2 guidelines and lentivirus handling, refer to the document, Biosafety in Microbiological and Biomedical Laboratories, 4th Edition, published by the Centers for Disease Control (CDC) (www.cdc.gov/biosafety/publications/index.htm).
Lentiviruses produced with our system do not carry or express any viral genes, and therefore have no associated toxicity issues. Only the protein expressed from the coding region between the LTR sites is incorporated into the mammalian cell chromosome and expressed. The lentivirus itself cannot replicate because of the built-in safety features.
The concern with leaving the lentivirus on the cells longer would be potential toxicity or growth effects. If you absolutely cannot remove the virus from the cells, we suggest to leave it on the cells and empirically monitor the cells.
Note: These are based on the characteristics of HIV.
Morphology: Virions have a complex construction and consist of an envelope, a nucleocapsid, a nucleoid, and a matrix protein. Virions are enveloped, spherical to pleomorphic in shape, and have a size of 80-100 nm in diameter. The surface projections are small or inconspicuous spikes that are densely dispersed, evenly covering the surface. Surface projections are 8 nm long. The core is rod-shaped, or is truncated cone-shaped. The nucleoid is concentric.
Physicochemical and Physical Properties: Virions have a buoyant density in sucrose of 1.13-1.18 g cm-3. Virions are sensitive to treatment with heat, detergents, and formaldehyde. The infectivity is not affected by irradiation.
Proteins: Proteins constitute about 60% of the particle weight. The viral genome encodes structural proteins and non-structural proteins. Virions consist of 5 major structural and 3 non-structural proteins. The virus codes for an RNA-dependent DNA polymerase.
Lipids: Lipids are present and located in the envelope. Virions are composed of 35% lipids by weight. The composition of viral lipids and host cell membranes are similar. The lipids are of host origin, derived from plasma membranes.
Carbohydrates: Three percent of the particle weight is attributed to carbohydrates.
Polybrene (hexadimethrine bromide) is a cationic polymer(Cat. No. H9268 from Sigma Aldrich) that increases transduction efficiency by neutralizing the charge repulsion between virus particles and the cell surface. For best results, we recommend performing transduction in the presence of Polybrene.
Note: Some cells (e.g., primary neurons) are sensitive to Polybrene. Hence, before performing a transduction experiment, we recommend testing your cell line for sensitivity to Polybrene at a range of 0-10 µg/mL and avoiding it if the cells exhibit toxicity or phenotypic changes.
We have found that, in general, 80-90% of the cells in an actively dividing cell line (e.g., ht1080) express a target gene when transduced with lentivirus at an MOI of approximately 1. Some non-dividing cell types transduce lentiviral constructs less efficiently. For example, only about 50% of the cells in a culture of primary human fibroblasts express a target gene when transduced at an MOI of approximately 1. If you are transducing your lentiviral construct into a non-dividing cell type, you may need to increase the MOI (e.g., MOI = 10) to achieve optimal expression levels for your recombinant protein. If you are transducing your lentiviral construct into your mammalian cell for the first time, we recommend using a range of MOIs (e.g., 0, 0.5, 1, 2, 5, 10) to determine the MOI required to obtain the optimal protein expression for your application.
The lentiviral envelope is pseudotyped with the vesicular stomatitis virus glycoprotein (VSV-G), which allows the lentivirus to interact with its target cell in a receptor-independent manner. As a result, lentivirus has broad tropism and can, in theory, transduce any mammalian cell type. This receptor-independent entry into the target cell likely involves endocytosis (Espenshade et al. (2002) Proc Natl Acad Sci U S A 99:11694; Aiken (1997) J Virol 71:5871).
You can perform PCR/qPCR analysis of viral genes for lentivirus titering, but keep in mind that the titer will not be a measure of functional virus since it will measure both inactive as well as active virus. As a result, titers obtained using this method are usually about 10-fold higher than with methods that measure functional virus, such as blasticidin selection.
You can use the p24 ELISA assay for lentivirus titering, but keep in mind that the titer will not be a measure of functional virus since it will measure both inactive as well as active virus. As a result, titers obtained using this method are usually about 10-fold higher than with methods that measure functional virus, such as blasticidin selection.
We strongly recommend the human fibrosarcoma cell line ht1080 Cells (ATCC# CCL-121) as the gold standard for titering lentivirus. The primary reason is that transduction efficiency is high in these cells, and titering results are very accurate and reproducible. However, you may also use the same mammalian cell line to titer your lentiviral stocks as you will use to perform your expression studies. In general, this should be an adherent, non-migratory cell line, and exhibit a doubling time in the range of 18-25 hours. Regular 293 cells may be used for lentivirus titering, but we do not recommend using 293T or 293FT cells because these cells contain the SV40 large T antigen that will induce unwanted DNA replication at the SV40 ori contained within the integrated lentiviral expression vector. This often leads to cell death and results in very low titers.Lentivirus is a genus of slow retroviruses, characterized by a long incubation period.
Yes, we do offer a lentivirus production custom service. Please send an email to techsupport@thermofisher.com for details.
Lentivirus produced using our system is replication-incompetent, and this is a safety feature. You must perform a fresh transfection each time you need more virus.
Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.
We recommend aliquoting lentiviral stocks immediately after production into small working volumes, and storing at -80 degrees C for long-term storage. Lentivirus is sensitive to storage temperature and to freeze/thaw and should be handled with care. It can lose up to 5% or more activity with each freeze/thaw. When stored properly, viral stocks of an appropriate titer should be suitable for use for up to one year. After long-term storage, we recommend re-titering your viral stocks before use.
The F stands for the high transfection efficiency of this particular 293 cell clone (called 293F) and the T stands for the SV40 large T antigen. The large T antigen expression plasmid is stably integrated in the genome and confers resistance to Geneticin antibiotic in these cells. The presence of the SV40 large T antigen is important for high-titer lentivirus production and the mechanism is not known. If regular 293 cells or another 293T cell line is used as the producer cell line, you will be able to produce virus, but the titers will be lower.
The size of the wild-type HIV-1 genome is approximately 10 kb. Since the size of the elements required for expression from pLenti vectors adds up to approximately 4-4.4 kb, the size of your gene of interest should theoretically not exceed 5.6-6 kb for efficient packaging. Titers will generally decrease as the size of the insert increases.
The ViraPower Lentiviral Packaging Mix consists of an optimized mixture of three viral packaging plasmids, pLP1, pLP2, and pLP VSVG, supplied at 1 mg/mL in TE buffer, pH 8.0. The individual plasmids are not available as standalones.
Our lentiviral packaging mix belongs to the third generation, meaning that it does not express the tat gene. It can be used with lentiviral vectors that belong to the third generation or higher, where virus production is independent of the tat gene.
Your second-generation lentiviral vector will not be compatible with our packaging mix because our packaging mix belongs to the third generation, meaning that it does not express the tat gene; whereas your lentiviral vector will need the tat gene for virus production.
Our lentiviral expression vectors belong to the third generation, meaning that they contain a chimeric 5' LTR, by means of which virus production is not dependent on the HIV tat transactivator. As a result, they are compatible with a second- or third-generation packaging mix.
Our lentiviral packaging mix belongs to the third generation, meaning that it does not express the tat gene. Further, gag/pol and rev genes are supplied as independent plasmids, thus eliminating concerns about recombination events bringing components together as a single vector to produce replication-competent lentivirus.
Our lentiviral expression vectors belong to the third generation, meaning that we use a four-plasmid vector system (1 lentiviral expression vector and 3 packaging plasmids), thus eliminating concerns about recombination events bringing components together as a single vector to produce replication-competent lentivirus. Gag/pol and rev genes are supplied as independent plasmids. Further, these vectors contain a chimeric 5' LTR, by means of which virus production is not dependent on the HIV tat transactivator. Also, the original U3 region of the LTR (long terminal repeat) is deleted to make the virus self-inactivating and thus replication-incompetent.
Our lentiviral expression vectors contain approximately 20% of the original viral genome. The rest of the viral genome is deleted from our lentiviral expression vectors for safety reasons.
The main difference between these systems is in the lentiviral expression vector contained within the kits. The ViraPower Lentiviral Expression Vector backbone is similar to the ViraPower HiPerform Lentiviral Expression Vector backbone except that the latter contains two new elements: WPRE (Woodchuck Posttranscriptional Regulatory Element) from the woodchuck hepatitis virus that is placed directly downstream of the gene of interest, allowing for increased transgene expression and the cPPT (central Polypurine Tract) from the HIV-1 integrase gene, which increases the copy number of lentivirus integrating into the host genome and thus allowing for a two-fold increase in viral titer. Together, WPRE and cPPT produce at least a four-fold increase in protein expression in most cell types, compared to the vectors in the ViraPower Lentiviral Expression Systems that do not contain these elements. In the ViraPower HiPerform Fast Titer Expression System, in addition to the WPRE and cPPT elements, the lentiviral expression vector contains the EmGFP reporter gene instead of Bsd, which allows titer of active virus by flow cytometry in just two days post-transduction.
Inserts cloned into lentiviral vectors should not have a poly(A) signal. The native poly(A) signal (AATAAA or something similar) will be amplified when using the oligo dT during cDNA synthesis. Thus, it will then become part of the cDNA library or its clones.
Since lentivirus is an RNA virus, during the synthesis of the RNA genome to be packaged, if there is a polyadenylation (poly(A)) signal in the insert, the RNA will be terminated prematurely. There is a SV40 poly(A) signal in the vector, but it is after the second LTR, and it is supposed to be there. Almost any clone transferred from a Gateway cDNA library will probably have a poly(A) signal, which, if inserted into a lentiviral vector, would end up terminating the viral RNA prematurely.
In order to circumvent premature termination of the lentiviral RNA, consider these recommendations:
- The desired gene should first be isolated from the library, cloned into an entry vector such as pENTR/D-TOPO without the poly(A) signal (i.e., ATG to Stop), and then transferred into the lentiviral vector.
- If you are trying to establish a lentiviral expression library, you will probably have to go with a library that was amplified using random hexamers rather than an oligo dT, since such a library would be less likely to include a poly(A) signal in the insert.
Size is not usually a problem. The insert size limit of the lentivirus is approximately 5-6 kb (average insert size of the SuperScript II premade libraries is approximately 1.5 kb).
In pLenti6 vectors, the blasticidin (Bsd) resistance marker is driven by the SV40 promoter whereas in pLenti6.2 vectors, the Bsd resistance marker is driven by the phosphoglycerate kinase-1 (PGK) promoter.
This difference is important when working with stem cells; the PGK promoter is a native mammalian promoter that is resistant to silencing and shows long-term, persistent expression in stem cells, whereas the SV40 promoter is often silenced over time in primary cells and stem cells.
The complete kit composition is listed in the product manual under Kit Contents and Storage. Search our website (www.thermofisher.com) using the catalog number to find the product you're interested in. Once you are on the product page, the manual can be viewed and downloaded using the Manuals link. We provide a variety of vectors/kits to suit the various cloning and expression strategies used by different researchers.
We carry the Vivid Colors pLenti6.3/V5-GW/EmGFP Expression Control Vector (Cat. No. V37006) and Vivid Colors pLenti6.2-GW/EmGFP Expression Control Vector (Cat. No. V36920), both of which are lentiviral vectors containing Emerald Green Fluorescent Protein (EmGFP). They are designed for use with the ViraPower Lentiviral Expression Systems as positive controls to enable the detection of EmGFP fluorescence following transfection in 293FT cells. These vectors serve as titer controls to produce an EmGFP-expressing lentivirus stock and as a transduction control following transduction in both dividing and non-dividing mammalian cells. Both of these vectors are not cloning vectors. The Vivid Colors pLenti6.3/V5-GW/EmGFP Expression Control Vector has the CMV promoter for driving constitutive expression of EmGFP and the PGK promoter for driving long-term, persistent expression of the blasticidin-stable selection marker, whereas the Vivid Colors pLenti6.2-GW/EmGFP Expression Control Vector has the CMV promoter for driving constitutive expression of EmGFP and the SV40 promoter for driving expression of the blasticidin-stable selection marker. In addition, the Vivid Colors pLenti6.3/V5-GW/EmGFP Expression Control Vector is a HiPerform vector, meaning that it is equipped with two key genetic elements: the Woodchuck Posttranscriptional Regulatory Element (WPRE) and the central Polypurine Tract (cPPT) sequence from the HIV-1 integrase gene to produce at least 4-fold increase in increase in protein expression in most cell types, compared to lentiviral vectors that do not contain these elements.
Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.
All our pLenti expression vectors have 2 poly(A) sites-a poly(A) located within the 3' LTR that is derived from HIV-1 and the SV40 poly(A) downstream of the 3'LTR. The reason for having both is to reduce the chances of transcriptional interference (for instance, if there were a significant amount of transcriptional read-through that continued through the RSV promoter region, this could potentially interfere with transcription from the RSV promoter, which is critical for production of the viral RNA). Once the lentivirus has integrated in the target cells, the SV40 poly(A) will not be present (since the virus just extends from the 5' to 3' LTR), but the poly(A) within the 3' LTR region will still be present and functional.
The HIV-1 genome consists of two identical copies of single-stranded RNA. Generating dsRNA, as could happen in this instance, will reduce titers since the dsRNA will interfere with genome packaging. Hence, reversing the orientation of the expression cassette with respect to the LTRs will decrease virus titers. Reference: Mautino et al. (2000) Human Gene Therapy 11:895.
Yes, the lentiviral expression vector will work as an expression vector by itself and can be stably selected with the appropriate antibiotic. Please note that the vector will be about twice the size of most regular vectors. Therefore, you may need to increase the amount of transfected vector to approximate molar equivalents.
Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.
We do not recommend using a mini-prep kit for propagation of lentiviral constructs because the DNA yield from lentiviral mini-prep DNA is often very low due to the presence of the LTRs in the vector backbone. We recommend preparing lentiviral plasmid DNA using the S.N.A.P. MidiPrep Kit (Cat. No. K191001) or PureLink HiPure Plasmid Midiprep Kit (Cat. No. K210004), both of which contain 10 mM EDTA in the Resuspension Buffer. Since lentiviral DNA midi-preps also often have low DNA yields, we recommend following specific protocols to increase yield-basically, grow cells slowly, use fewer cells per column, and use 100 mL lentivirus culture for each DNA midi-prep.
Note: If you are going to be mini-prepping the lentiviral plasmid during the cloning/colony screening processes, we recommend using the PureLink HQ Mini Kit (Cat. No. K210001) and following the manual protocol with one change: only a single elution with 50 mL TE, pH 8.0 buffer. The typical yield with this method is normally pretty low: 100-150 ng/mL (i.e., 5-7 mg total). The OD 260/280 is typically between 1.8 and 2.1.
We recommend storing lentiviral expression vectors at -20 degrees C. Due to their relatively large size, we do not recommend storing these vectors at -80 degrees C, as the vector solution will completely freeze and too many freeze thaws from -80 degrees C will affect the cloning efficiency.
The TOPO cloning method is an easy-to-use, 5-minute benchtop PCR cloning method, and we have developed many kits based on this technology. You may want to choose this method if you have only one construct to make. If you plan to place your gene of interest into several different expression systems, you may want to consider Gateway cloning technology, also used in many of our expression kits. Another consideration in choosing the cloning method would be the size of your insert. If your insert is >4 kb, we recommend choosing Gateway cloning, as TOPO cloning will not work efficiently for these large inserts.
Our lentiviral vectors are based on the HIV-1 backbone. However, several alterations have been made so they function solely as a gene delivery vehicle without subsequent viral replication or disease. Specific HIV-1 genes have been deleted to enhance safety. The HIV-1 genes are only expressed in the producer cells (293FT) and none of them are packaged into the viral genome, and thus are never expressed in the transduced target cell.
Lentivirus is a genus of slow retroviruses, characterized by a long incubation period.
If you are interested in stable integration and selection, choose the lentiviral system. We offer both a Directional TOPO (D-TOPO) and Gateway version of the kit to provide flexibility in the cloning of the gene of interest. If you are looking for transient gene expression, choose the adenoviral system. We offer the Gateway cloning method for this product. Adenoviral vectors can be amplified several times in 293A cells, whereas the only method to concentrate lentivirus is by centrifugation. Adenovirus requires that host cells have th CAR receptor for efficient transduction, whereas due to the VSVG membrane coat on lentivirus particles, these viruses have broad tropism for a variety of mammalian cell types.
It should be noted, however, that gene expression from both systems is typically detected within 24-48 hours of transduction, so both systems can be used for experiments of a transient nature. The main difference is that lentivirus integrates into the host genome and adenovirus does not. Higher viral titers are achieved with the adenovirus.
MOI stands for multiplicity of infection. Theoretically, an MOI of 1 will provide 1 virus particle for each cell on a plate, while an MOI of 10 represents ten virus particles per cell. However, several factors can influence the optimal MOI including the nature of your mammalian cell line, (non-dividing vs. dividing), transduction efficiency, your application of interest, and your protein of interest.
When transducing your adenoviral or lentiviral construct into the mammalian cell line of choice for the first time, we recommend using a range of MOIs (0, 0.5, 1, 2, 5, 10, 50) to determine the MOI required to obtain optimal gene expression. MOIs greater than 50, such as MOI 100, are common for the transduction of neurons with lentivirus. After you determine the MOI that gives optimal gene expression, subsequent transductions can be performed at the optimal MOI.
Adenoviral expression is used for transient expression, whereas lentiviral expression is used for longer-term expression. Adenoviral vectors can be amplified several times in 293A cells, whereas the only method to concentrate lentivirus is by centrifugation. Adenovirus requires that host cells have the CAR receptor for efficient transduction, whereas due to the VSVG membrane coat on lentivirus particles, these viruses have broad tropism for a variety of mammalian cell types.
There is no theoretical limit to insert size for a BP reaction with a pDONR vector. Maximum size tested in-house is 12 kb. TOPO vectors are more sensitive to insert size and 3-5 kb is the upper limit for decent cloning efficiency.
After generating your attB-PCR product, we recommend purifying it to remove PCR buffer, unincorporated dNTPs, attB primers, and any attB primer-dimers. Primers and primer-dimers can recombine efficiently with the Donor vector in the BP reaction and may increase background after transformation into E. coli, whereas leftover PCR buffer may inhibit the BP reaction. Standard PCR product purification protocols using phenol/chloroform extraction followed by ammonium acetate and ethanol or isopropanol precipitation are not recommended for purification of the attB-PCR product as these protocols generally have exclusion limits of less than 100 bp and do not efficiently remove large primer-dimer products. We recommend a PEG purification protocol (see page 17 of the Gateway Technology with Clonase II manual). If you use the above protocol and your attB-PCR product is still not suitably purified, you may further gel-purify the product. We recommend using the PureLink Quick Gel Extraction kit.
Check the genotype of the cell strain you are using. Our Gateway destination vectors typically contain a ccdB cassette, which, if uninterrupted, will inhibit E. coli growth. Therefore, un-cloned vectors should be propagated in a ccdB survival cell strain, such as our ccdB Survival 2 T1R competent cells.
LR Clonase II Plus contains an optimized formulation of recombination enzymes for use in MultiSite Gateway LR reactions. LR Clonase and LR Clonase II enzyme mixes are not recommended for MultiSite Gateway LR recombination reactions, but LR Clonase II Plus is compatible with both multi-site and single-site LR recombination reactions.
When the LR reaction is complete, the reaction is stopped with Proteinase K and transformed into E. coli resulting in an expression clone containing a gene of interest. A typical LR reaction followed by Proteinase K treatment yields about 35,000 to 150,000 colonies per 20ul reaction. Without the Proteinase K treatment, up to a 10 fold reduction in the number of colonies can be observed. Despite this reduction, there are often still enough colonies containing the gene of interest to proceed with your experiment, so the Proteinase K step can be left out after the LR reaction is complete if necessary.
In most cases, there will not be enough pENTR vector DNA present to go directly from TOPO cloning into an LR reaction. You need between 100-300 ng of pENTR vector for an efficient LR reaction, and miniprep of a colony from the TOPO transformation is necessary to obtain that much DNA. However, if you want to try it, here are some recommendations for attempting to go straight into LR reactions from the TOPO reaction using pENTR/D, or SD TOPO, or pCR8/GW/TOPO vectors:
1. Heat inactivate the topoisomerase after the TOPO cloning reaction by incubating the reaction at 85 degrees C for 15 minutes.
2. Use the entire reaction (6 µL) in the LR clonase reaction. No purification steps are necessary.
3. Divide the completed LR reaction into 4 tubes and carry out transformations with each tube. You cannot transform entire 20 µL reaction in one transformation, and we have not tried ethanol precipitation and then a single transformation.
When attempting this protocol, we observed very low efficiencies (~10 colonies/plate). So just be aware that while technically possible, going directly into an LR reaction from a TOPO reaction is very inefficient and will result in a very low colony number, if any at all.
To have an N-terminal tag, the gene of interest must be in the correct reading frame when using non-TOPO adapted Gateway entry vectors. All TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame, and to add the N-terminal tag you simply recombine with a destination vector that has N-terminal tag.
To attach a C-terminal tag to your gene of interest, the insert must lack its stop codon, and be in the correct reading frame for compatibility with our C-terminal tagged destination vectors. Again, TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame. If you do not want the C-terminal tag to be expressed, simply include a stop codon at the end of the insert that is in frame with the initial ATG.
Generally, you need to choose a destination vector before you design and clone your insert into the Entry vector. This will determine whether you need to include an initiating ATG or stop codon with your insert.
No, not directly. The attB-PCR product must first be cloned, via a BP Clonase reaction, into a pDONR vector which creates an "Entry Clone" with attL sites. This clone can then be recombined, via an LR Clonase reaction, with a Destination vector containing attR sites. However, It is possible to perform both of these reactions in one step using the "One-Tube Protocol" described in the manual entitled "Gateway Technology with Clonase II".
Yes, this can be done using the Multisite Gateway Technology. MultiSite Gateway Pro Technology enables you to efficiently and conveniently assemble multiple DNA fragments - including genes of interest, promoters, and IRES sequences - in the desired order and orientation into a Gateway Expression vector. Using specifically designed att sites for recombinational cloning, you can clone two, three, or four DNA fragments into any Gateway Destination vector containing attR1 and attR2 sites. The resulting expression clone is ready for downstream expression and analysis applications.
For the BP reaction, approximately 5-10% of the starting material is converted into product. For the LR reaction, approximately 30% of the starting material is converted into product.
The core region of the att sites contains the recognition sequence for the restriction enzyme BsrGI. Provided there are no BsrGI sites in the insert, this enzyme can be used to excise the full gene from most Gateway plasmids. The BsrGI recognition site is 5'-TGTACA and is found in both att sites flanking the insertion site.
If a different restriction site is desired, the appropriate sequence should be incorporated into your insert by PCR.
We do have an alternative method called the "attB Adapter PCR" Protocol in which you make your gene specific primer with only 12 additional attB bases and use attB universal adapter primers. This protocol allows for shorter primers to amplify attB-PCR products by utilizing four primers instead of the usual two in a PCR reaction. You can find the sequence of these primers in the protocol on page 45 of the "Gateway Technology with Clonase II" manual.
There is a protocol in which all 4 primers mentioned above are in a single PCR reaction. You can find this protocol at in the following article: Quest vol. 1, Issue 2, 2004. https://www.thermofisher.com/us/en/home/references/newsletters-and-journals/quest-archive.reg.in.html. The best ratio of the first gene-specific and the second attB primers was 1:10.
We do not offer pre-made primers, but we can recommend the following sequences that can be ordered as custom primers for sequencing of pDONR201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC
1. Yeast two-hybrid protein-protein interaction studies Walhout AJ, Sordella R, Lu X, Hartley JL, Temple GF, Brasch MA, Thierry-Mieg N, Vidal M.
2. Protein Interaction Mapping in C. elegans Using Proteins Involved in Vulval Development. Science Jan 7th 2000; 287(5450), 116-122 Davy, A. et al.
3. A protein-protein interaction map of the Caenorhabditis elegans 26S proteosome. EMBO Reports (2001) 2 (9), p. 821-828. Walhout, A.J.M. and Vidal, M. (2001).
4. High-throughput Yeast Two-Hybrid Assays for Large-Scale Protein Interaction mapping. Methods: A Companion to Methods in Enzymology 24(3), pp.297-306
5. Large Scale Analysis of Protein Complexes Gavin, AC et al. Functional Organization of the Yeast Proteome by Systematic Analysis of Protein Complexes. Nature Jan 10th 2002, 415, p. 141-147.
6. Systematic subcellular localisation of proteins Simpson, J.C., Wellenreuther, R., Poustka, A., Pepperkok, R. and Wiemann, S.
7. Systematic subcellular localization of novel proteins identified by large-scale cDNA sequencing. EMBO Reports (2000) 1(3), pp. 287-292.
8. Protein-over expression and crystallography Evdokimov, A.G., Anderson, D.E., Routzahn, K.M. & Waugh, D.S.
9. Overproduction, purification, crystallization and preliminary X-ray diffraction analysis of YopM, an essential virulence factor extruded by the plague bacterium Yersinia pestis. Acta Crystallography (2000) D56, 1676-1679.
10. Evdokimov, et al. Structure of the N-terminal domain of Yersinia pestis YopH at 2.0 A resolution. Acta Crystallographica D57, 793-799 (2001).
11. Lao, G. et al. Overexpression of Trehalose Synthase and Accumulation of Intracellular Trehalose in 293H and 293FTetR:Hyg Cells. Cryobiology 43(2):106-113 (2001).
12. High-throughput cloning and expression Albertha J. M. Walhout, Gary F. Temple, Michael A. Brasch, James L. Hartley, Monique A. Lorson, Sander Van Den Huevel, and Marc Vidal.
13. Gateway Recombinational Cloning: Application to the Cloning of Large Numbers of Open Reading Frames or ORFeomes. Methods in Enzymology, Vol. 328, 575-592.
14. Wiemann, S. et.al., Toward a Catalog of Human Genes and Proteins: Sequencing and Analysis of 500 Novel Complete Protein Coding Human cDNAs, Genome Research (March 2001) Vol. 11, Issue 3, pp.422-435
15. Reviewed in NATURE: Free Access to cDNA provides impetus to gene function work. 15 march 2001, p. 289. Generating directional cDNA libraries using recombination
16. Osamu Ohara and Gary F. Temple. Directional cDNA library construction assisted by the in vitro recombination reaction. Nucleic Acids Research 2001, Vol. 29, no. 4. RNA interference (RNAi)
17. Varsha Wesley, S. et al. Construct design for efficient, effective and highthroughput gene silencing in plants. The Plant Journal 27(6), 581-590 (2001). Generation of retroviral constructs
18. Loftus S K et al. Generation of RCAS vectors useful for functional genomic analyses. DNA Res 31;8(5):221 (2001).
19. James L. Hartley, Gary F. Temple and Michael A. Brasch. DNA Cloning Using In Vitro Site-Specific Recombination. Genome Research (2000) 10(11), pp. 1788-1795.
20. Reboul et al. Open-reading frame sequence tags (OSTs) support the existence of at least 17,300 genes in C. elegans. Nature Genetics 27(3):332-226 (2001).
21. Kneidinger, B. et al. Identification of two GDP-6-deoxy-D-lyxo-4-hexulose reductase synthesizing GDP-D-rhamnose in Aneurinibacillus thermoaerophilus L420-91T*. JBC 276(8) (2001).
The attP1 sequence (pDONR) is:
AATAATGATT TTATTTTGAC TGATAGTGAC CTGTTCGTTG CAACAAATTG ATGAGCAATGCTTTTTTAT AATGCCAACT TTGTACAAAA AAGC[TGAACG AGAAACGTAA AATGATATAA ATATCAATAT ATTAAATTAG ATTTTGCATA AAAAACAGACTA CATAATACTG TAAAACACAA CATATCCAGT CACTATGAAT CAACTACTTA GATGGTATTA GTGACCTGTA]
The region within brackets is where the site is "cut" and replaced by the attB1-fragment sequence to make an attL1 site. The sequence GTACAAA is the overlap sequence present in all att1 sites and is always "cut" right before the first G.
The overlap sequence in attP2 sites is CTTGTAC and cut before C. This is attP2:
ACAGGTCACT AATACCATCT AAGTAGTTGA TTCATAGTGA CTGGATATGT TGTGTTTTAC AGTATTATGT AGTCTGTTTT TTATGCAAAA TCTAATTTAA TATATTGATA TTTATATCAT TTTACGTTTC TCGTTCAGCT TTCTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT AATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT
So, attL1 (Entry Clone) should be:
A ATAATGATTT TATTTTGACT GATAGTGACC TGTTCGTTGC AACAAATTGA TGAGCAATGC TTTTTTATAA TGCCAACT TT G TAC AAA AAA GC[A GGC T]NN NNN
attL2 (Entry Clone) should be:
NNN N[AC C]CA GCT TT CTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT CAATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT
The sequence in brackets comes from attB, and N is your gene-specific sequence.
Note: When creating an Entry Clone through the BP reaction and a PCR product, the vector backbone is not the same as Gateway Entry vectors. The backbone in the case of PCR BP cloning is pDONR201.
There is no size restriction on the PCR fragments if they are cloned into a pDONR vector. The upper limit for efficient cloning into a TOPO adapted Gateway Entry vector is approximately 5 kb. A Gateway recombination reaction can occur between DNA fragments that are as large as 150 kb.
Destination vectors that contain N-terminal fusion partners will express proteins that contain amino acids contributed from the attB1 site, which is 25 bases long. This means that in addition to any tag (6x His and/or antibody epitope tag), the N-terminus of an expressed protein will contain an additional 9 amino acids from the attB1 sequence - the typical amino acid sequence is Thr-Ser-Leu-Tyr-Lys-Lys-Ala-Gly-nnn, where nnn will depend on the codon sequence of the insert.
Effects on protein function: A researcher (Simpson et al. EMBO Reports 11(31):287-292, 2000) demonstrated that GFP fusions (N- terminal and C-terminal) localized to the proper intracellular compartment. The expression constructs were generated using Gateway cloning, so the recombinant protein contained the attB1 or attB2 amino acid sequence. The localization function of the cloned recombinant proteins was preserved.
Effects on expression: We have seen no effect of the attB sites on expression levels in E. coli, insect and mammalian cells. The gus gene was cloned into bacterial expression vectors (for native and N-terminal fusion protein expression) using standard cloning techniques and expressed in bacteria. Gus was also cloned into Gateway Destination vectors (for native and N-terminal fusion expression) and expressed. When protein expression is compared, there was no difference in the amount of protein produced. This demonstrates that for this particular case, the attB sites do not interfere with transcription or translation.
Effects on solubility: A researcher at the NCI has shown that Maltose Binding Protein fusions constructed with Gateway Cloning were soluble. The fusion proteins expressed had the attB amino acid sequence between the Maltose Binding Protein and the cloned protein. It is possible that some proteins containing the attB sequence could remain insoluble when expressed in E.coli.
Effects on folding: Two Hybrids screens show the same interacters identified with and without the attB sequence. Presumably correct protein folding would be required for protein-protein interactions to take place. It is possible that some proteins containing the attB sequence may not fold correctly.
Since the attB sequences are on the 5' end of oligos, they will not anneal to the target template in the first round of PCR. Sometimes the PCR product is more specific with the attB primers, probably due to the longer annealing sequence (all of attB plus gene specific sequence) after the first round of amplification. Generally there is no need to change PCR reaction conditions when primers have the additional attB sequence
No, this is not really feasible due to the fact that the attL sequence is approximately 100 bp, which is too long for efficient oligo synthesis. Our own maximum sequence length for ordering custom primers is 100 nucleotides. In contrast, the attB sequences are only 25 bp long, which is a very reasonable length for adding onto the 5' end of gene-specific PCR primers.
Vector information can be found in the product manuals or directly on our web site by entering the catalog number of the product in the search box. The vector map, cloning site diagram, and sequence information will be linked to the product page.
The Gateway nomenclature is consistent with lambda nomenclature, but we use numbers to differentiate between modified versions of the att sites (attB1, attB2, attP1, attP2, and so on). We have introduced mutations in the att sites to provide specificity and directionality to the recombination reaction. For example, attB1 will only recombine with attP1 and not with attP2.
The first step is to create an Entry clone for your gene of interest. We have 3 options to do this: The first is by BP recombination reaction using the PCR Cloning System with Gateway Technology. This is recommended for cloning large (>5 kb) PCR products. We also have Gateway compatible TOPO Cloning vectors such as pCR8/GW/TOPO and pENTR/D-TOPO. The final option is to use restriction enzymes to clone into a pENTR Dual Selection vector.
The gene of interest must be flanked by the appropriate att sites, either attL (100 bp) in an Entry clone or attB (25 bp) in a PCR product. For Entry clones, everything between the attL sites will be shuttled into the Gateway destination vector containing attR sites, and a PCR product flanked by attB sites must be shuttled into an attP-containing donor vector such as pDONR221.
The location of translation initiation sites, stop codons, or fusion tags for expression must be considered in your initial cloning design. For example, if your destination vector contains an N-terminal tag but does not have a C-terminal tag, the vector should already contain the appropriate translation start site but the stop codon should be included in your insert.
Yes, increasing the incubation time from 1 hour to 4 hours will generally increase colony numbers 2-3 fold. An overnight incubation at room temperature will typically increase colony yield by 5-10 fold.
BP Clonase II and LR Clonase II can be freeze/thawed at least 10 times without significant loss of activity. However, you may still want to aliquot the enzymes to keep freeze/thaw variability to a minimum.
These enzymes are more stable than the original BP and LR Clonase and can be stored at -20 degrees C for 6 months.
Mini-prep (alkaline lysis) DNA preparations work well in Gateway cloning reactions. It is important that the procedure remove contaminating RNA for accurate quantification. Plasmid DNA purified with our S.N.A.P. nucleic acid purification kits, ChargeSwitch kits, or PureLink kits are recommended.
A simple way to express a protein with a leader sequence is to have the leader sequence encoded in the destination vector. The other option is to have the leader sequence subcloned into the entry vector using restriction enzymes, or incorporate the leader sequence into the forward PCR primer when cloning a PCR product into the entry vector. Please see Esposito et al. (2005), Prot. Exp. & Purif. 40, 424-428 for an example of how a partial leader sequence for secretion was incorporated into an entry vector.
This depends on whether you are expressing a fusion or a native protein in the Gateway destination vector. For an N-terminal fusion protein the ATG will be given by the destination vector and it will be upstream of the attB1 site. For a C-terminal fusion protein or a native protein, the ATG should be provided by your gene of interest, and it will be downstream of the attB1 site.
The Gateway attB sites are derived from the bacteriophage lambda site-specific recombination, but are modified to remove stop codons and reduce secondary structure. The core regions have also been modified for specificity (i.e., attB1 will recombine with attP1 but not with attP2).
Expression experiments have shown that the extra amino acids contributed by the attB site to a fusion protein will most likely have no effect on protein expression levels or stability. In addition, they do not appear to have any effect on two-hybrid interactions in yeast. However, as is true with the addition of any extra sequences that result from tags, the possible effects will be protein-dependent.
No, attB primers are highly specific under standard PCR conditions. We have amplified from RNA (RT-PCR), cDNA libraries, genomic DNA, and plasmid templates without any specificity problems.
The smallest size we have recombined is a 70 bp piece of DNA located between the att sites. Very small pieces are difficult to clone since they negatively influence the topology of the recombination reaction.
There is no theoretical size limitation. PCR products between 100 bp and 11 Kb have been readily cloned into a pDONR Gateway vector. Other DNA pieces as large as 150 kb with att sites will successfully recombine with a Gateway-compatible vector. Overnight incubation is recommended for large inserts.
Standard desalted purity is generally sufficient for creating attB primers. We examined HPLC-purified oligos for Gateway cloning (about 50 bp long) and found only about a 2-fold increase in colony number over standard desalted primers. If too few colonies are obtained, you may try to increase the amount of PCR product used and/or incubate the BP reaction overnight.