Search
Search
View additional product information for pENTR™ 5'-TOPO™ TA Cloning™ Kit, with One Shot™ TOP10 Chemically Competent E. coli - FAQs (K59120)
96 product FAQs found
We do not recommend storing competent E. coli strains in liquid nitrogen as the extreme temperature can be harmful to the cells. Also, the plastic storage vials are not intended to withstand the extreme temperature and may crack or break.
We recommend storing our competent E. coli strains at -80°C. Storage at warmer temperatures, even for a brief period of time, will significantly decrease transformation efficiency.
The sequence of the control template is proprietary.
We suggest starting with a molar ratio of 1:1 (insert:vector), with a range of 0.5:1 to 2:1. The quantity used in a TOPO cloning reaction is typically 5-10 ng of a 2 kb PCR product.
Equation:
length of insert (bp)/length of vector (bp) x ng of vector = ng of insert needed for 1:1 (insert:vector ratio)
The optimal ratio is 1:1 insert to vector. Optimization can be done using a ratio of 0.5-2 molecules of insert for every molecule of the vector.
Equation:
length of insert (bp)/length of vector (bp) x ng of vector = ng of insert needed for 1:1 insert:vector ratio
Yes, the enzyme mix leaves 3' A-overhangs on a portion of the PCR products. However, the cloning efficiency is greatly decreased compared to that obtained with Taq polymerase alone. It is recommended to add 3' A-overhangs to the product for TA cloning.
There is no theoretical limit to insert size for a BP reaction with a pDONR vector. Maximum size tested in-house is 12 kb. TOPO vectors are more sensitive to insert size and 3-5 kb is the upper limit for decent cloning efficiency.
After generating your attB-PCR product, we recommend purifying it to remove PCR buffer, unincorporated dNTPs, attB primers, and any attB primer-dimers. Primers and primer-dimers can recombine efficiently with the Donor vector in the BP reaction and may increase background after transformation into E. coli, whereas leftover PCR buffer may inhibit the BP reaction. Standard PCR product purification protocols using phenol/chloroform extraction followed by ammonium acetate and ethanol or isopropanol precipitation are not recommended for purification of the attB-PCR product as these protocols generally have exclusion limits of less than 100 bp and do not efficiently remove large primer-dimer products. We recommend a PEG purification protocol (see page 17 of the Gateway Technology with Clonase II manual). If you use the above protocol and your attB-PCR product is still not suitably purified, you may further gel-purify the product. We recommend using the PureLink Quick Gel Extraction kit.
Using the vector only for transformation is not a recommended negative control. The process of TOPO-adaptation is not a 100% process, therefore, there will be vector only present in your mix, and colonies will be obtained.
Phosphorylated products can be TA cloned but not TOPO cloned. This is because the necessary phosphate group is contained within the topoisomerase-DNA intermediate complex of the vector. TOPO vectors have a 3' phosphate to which topoisomerase is covalently bound and a 5' phosphate. Non-TOPO linear vectors (TA and Blunt) have a 3' OH and a 5' phosphate. Phosphorylated products should be phosphatased (CIP) before TOPO cloning.
You may be cloning in an artifact. TA and TOPO Cloning are very efficient for small fragments (< 100 bp) present in certain PCR reactions. Gel-purify your PCR product using either a silica-based DNA purification system or electroelution. Be sure that all solutions are free of nucleases (avoid communal ethidium bromide baths, for example.)
There could be a few possibilities for this:
- The insert does not interrupt the reading frame of the lacZ gene. If you have a small insert (< 500 bp), you may have light blue colonies. Analyze some of these blue colonies as they may contain insert.
- A polymerase that does not add 3' A-overhangs was used. If you used a proofreading enzyme, you will need to do a post-reaction treatment with Taq polymerase to add the 3' A-overhangs.
- PCR products were gel-purified before ligation. Gel purification can remove the single 3' A- overhangs. Otherwise, optimization of your PCR can be performed so that you can go directly from PCR to cloning.
- The PCR products were stored for a long period of time before ligation reaction. Use fresh PCR products. Efficiencies are reduced after as little as 1 day of storage.
- Too much of the amplification reaction was added to the ligation. The high salt content of PCR can inhibit ligation. Use no more than 2-3 µl of the PCR mixture in the ligation reaction.
- The molar ratio of vector:insert in the ligation reaction may be incorrect. Estimate the concentration of the PCR product. Set up the ligation reaction with a 1:1 or 1:3 vector:insert molar ratio.
On a typical plate there are a few white colonies which do not contain insert. These are usually larger than the other colonies and are due to a deletion of a portion of the plasmid sequence by a rare recombination event (usually from the polylinker to a site in the F1 origin). To find a colony with an insert it is best to pick clones of a variety of color and pattern for analysis. Often an insert will generate two distinct patterns according to its orientation.
No colonies may occur due to the following problems:
Bacteria were not competent. Use the pUC18 vector included with the One Shot module to check the transformation efficiency of the cells.
- Incorrect concentration of antibiotic on plates, or the plates are too old. Use 100 µg/mL of ampicillin or 50 µg/mL kanamycin. Be sure ampicillin plates are fresh (< 1 month old).
- The product was phosphorylated (TOPO cloning only). Phosphorylated products can be TA-cloned but not TOPO-cloned. This is because the necessary phosphate group is contained within the topoisomerase-DNA intermediate complex of the vector. The TOPO vector has a 3' phosphate to which topoisomerase is covalently bound and a 5' phosphate. The non- TOPO vectors (TA and Blunt) have a 3' OH and a 5' phosphate. Phosphorylated products should be phosphatased (CIP) before TOPO-cloning.
Please consider the following possible causes:
- pH > 9: Check the pH of the PCR amplification reaction and adjust with 1 M Tris-HCl, pH 8.
- Excess (or overly dilute) PCR product: Reduce (or concentrate) the amount of PCR product.
- Incomplete extension during PCR: Be sure to include a final extension step of 7 to 30 minutes during PCR. Longer PCR products will need a longer extension time.
- Cloning large inserts (>1 kb): Try one or all of the following suggestions: Increase amount of insert. Incubate the TOPO cloning reaction longer. Gel-purify the insert using either a silica-based DNA purification system (e.g., PureLink system) or electroelution. Be sure that all solutions are free of nucleases (avoid communal ethidium bromide baths, for example.)
- PCR product does not contain sufficient 3' A-overhangs even though you used Taq polymerase: Increase the final extension time to ensure all 3' ends are adenylated. Taq polymerase is less efficient at adding a nontemplate 3' A next to another A. Taq is most efficient at adding a nontemplate 3' A next to a C. You may have to redesign your primers so that they contain a 5' G instead of a 5´ T.
Please try the suggestions below to increase the number of colonies.
- Longer incubation of the TOPO cloning reaction at room temperature, provided that the 6X Salt solution is added to the reaction.
- Electroporation can give significant increases in colony numbers; often 10-20 fold higher. However, if doing electroporation, it is important that the TOPO reaction mix contains diluted Salt solution or, for best results, precipitated prior to transformation. For high primary transformants by electroporation it is recommended to:
- Add 100 µL double diH2O to the 6 µL TOPO reaction and incubate 10 more minutes at 37 degrees C.
- Precipitate by adding 10 µL 3 M Na-Acetate, 2 µL 20 µg/µL glycogen, 300 µL 100% ethanol. Place on dry ice or –80 degrees C for 20 min, spin at top speed in a microcentrifuge at 4 degrees C for 15 min. Wash pellet with 800 µL 80% ethanol, spin at top speed for 10 min, pour off ethanol, spin 1 min, and remove remaining ethanol without disturbing pellet. Dry pellet (air-dry or speed-vac).
- Resuspend pellet in 10 µL ddH2O and electroporate 3.3 µL of resuspended DNA according to a normal electroporation protocol. This electroporation protocol can yield up to 20 fold more colonies than chemical transformation of an equivalent TOPO-reaction. The addition of the 100 µL ddH2O followed by 10 mins incubation is not absolutely necessary, but it sufficiently dilutes the reaction and may help inactivate topoisomerase so that it is more easily electroporated.
We would suggest using our TOPO TA cloning kit for sequencing, which contains the pCR 4 TOPO vector, or our Zero Blunt TOPO PCR cloning kit for sequencing, which contains the pCR4Blunt-TOPO vector.
Due to the small size of your product, we recommend using the pCR 2.1 TOPO vector for your cloning. This size fragment would not be able to fully interrupt the ccdB gene in the pCR4-TOPO vector, and therefore, you may not get colonies as ccdB is lethal to E. coli.
Regular TOPO TA Cloning kits are efficient for cloning PCR products up to approximately 2-3 kb. With PCR products larger than 3 kb, the efficiency of cloning drops significantly. The TOPO XL PCR Cloning Kit has been optimized for TOPO cloning of long (3-10 kb) PCR products.
If using the regular TOPO kits, here are some tips to improve efficiency:
1. Use crystal violet instead of ethidium bromide (EtBr) to visualize the PCR for gel isolation to avoid DNA nicks
2. Increase incubation time of the TOPO reaction to 30 mins
3. Keep insert:vector molar ratio low, optimally 1:1
4. Dilute reaction to 20 µL, while maintaining same amount of vector and insert. Increase the volume of the salt solution to 3.7 µL to compensate for the increase in volume. Diluting the reaction reduces the competition for the vector ends.
Storage of the TOPO vector plus insert reaction for 1 week at 4 degrees C has shown no detectable decrease in the cloning efficiency of the TOPO reaction, as >95% of the colonies have insert. However, the total number of colonies was decreased by 10-fold. Storage of the TOPO reaction mix overnight at 4 degrees C showed little to no decrease in the number of colonies when compared to fresh TOPO reaction mix.
The composition of the 6X Stop solution is 0.3 M NaCl, 0.06 M MgCl2, and the composition of the 6X Salt solution is 1.2 M NaCl, 0.06 M MgCl2. Stop solution is only included in the TOPO XL Cloning kit whereas Salt solution is currently included in all of the other TOPO cloning kits. These solutions prevent free topoisomerase from re-binding and nicking the plasmid, which would reduce the number of colonies from a TOPO reaction.
When doing a TOPO cloning reaction, 2 µl of a PCR reaction containing up to 10% DMSO or 1.3 M betaine will not interfere with the TOPO reaction. Formamide and high levels of glycerol will inhibit the reaction. These reagents are usually added to the PCR reaction to enhance the yield of the PCR product, e.g., to reduce the effect of secondary structure or assist in amplification of GC-rich sequences. The effects of tricine or acetamide have not been tested on the TOPO cloning reaction.
PCR primers should not have 5'-phosphates when cloning into any TOPO vector, as the presence of 5'-phosphates inhibit the TOPO cloning reaction. Phosphorylated products can be TA-cloned but not TOPO-cloned. This is because the necessary phosphate group is contained within the topoisomerase-DNA intermediate complex of the vector. TOPO vectors have a 3' phosphate to which topoisomerase is covalently bound and a 5' phosphate. Non-TOPO linear vectors (TA and Blunt) have a 3' OH and a 5' phosphate. Phosphorylated products should be treated with phosphatase (CIAP) prior to TOPO-cloning. Treatment with CIAP may raise efficiency to 25%. PCR products generated with 5'-biotinylated primers (or any other 5'-label including 5'-Cy5) will not ligate into any of the TOPO vectors due to steric hindrance.
Gel purification is not required if the gel indicates that the PCR product is clean with no visible non-specific bands or primer dimers. It is recommended if the PCR product is >1.5 kb or if non-specific bands and primer dimers are visible on the gel. Smaller products clone much more efficiently into the vector than larger products; therefore, they should be eliminated from the sample prior to cloning. There is some reduction in A-overhangs if the PCR product is gel purified, which along with PCR product loss during the procedure may slightly reduce total number of colonies. However, the percentage of colonies with insert does not change; it is typically >90% recombinant clones.
For optimal TOPO cloning, we recommend using fresh PCR products.
TA cloning ligates the insert and vector using a T4 DNA ligase, while TOPO TA cloning uses the intrinsic properties of topoisomerase, which ligates the insert and vector during a 5 minute desktop reaction. TOPO TA cloning results in >95% recombinants, while TA cloning results in >80% recombinants.
We offer a custom service for TOPO cloning adaptation services. Our scientists can prepare your vector for either blunt TOPO cloning, TOPO TA cloning, or directional TOPO cloning of PCR products.
Yes, our pCR.1 TOPO TA (Cat. No. 450641), pCR4-TOPO TA (Cat. No. 450030), pCRBluntII-TOPO (Cat. No. 450245) are available separately.
No, we do not recommend this as these vectors contain the topoisomerase DNA protein complex conjugated to the end of the vector.
We suggest starting with a molar ratio of 1:1 (insert:vector), with a range of 0.5:1 to 2:1 (insert:vector). The ng quantities should be between 5-10 ng of a 2 kb PCR product in a TOPO cloning reaction.
Please consider the following before TOPO cloning:
- TOPO cloning cannot ligate DNA with a 5' phosphate group.
- TOPO cloning will decrease in efficiency inversely with the size of the insert (above 3 kb) unless using the TOPO XL cloning kit.
- TOPO vectors contain different antibiotic resistance markers which should be considered before purchase.
- TOPO TA vectors accept fragments containing a 3' A overhang while Zero Blunt vectors accept fragments that are blunt-ended.
TOPO and TOPO TA vectors (non-directional) have phenol red dye added. The color should be pink (or yellow) at room temperature. If it turns blue when PCR product is added, the PCR product buffer is too basic and the number of transformed colonies will drop. When the solution is yellow, it signifies an acidic pH. At a pH 2.0, TOPO vectors still maintain high cloning efficiency. Directional TOPO and Zero Blunt TOPO vectors have bromophenol blue dye added.
Subcloning DH5? cells are a compatible strain, but you will get lower efficiency (10e6 vs 10e9) and therefore risk getting fewer clones. Top10F' is also compatible, but if blue/white screening is performed, IPTG along with X-gal will be needed for detection due to the expression of the lacIq repressor present in cells containing an F' episome.
Ensure that you are using the correct antibiotic at the appropriate concentration. Additionally, make sure the antibiotic is not expired. If colonies exhibit unexpected morphologies, contamination could be a factor. Check your S.O.C. medium and LB growth medium.
Here are a few suggestions:
- Small fragments/linkers are cloning in to your vector instead of your insert; to correct this, gel-purify the insert before ligation
- Ensure that the correct concentrations of X-gal and/or IPTG (if vector contains the lacIq marker) are used
- If spreading X-gal and/or IPTG on your plate, allow sufficient time for the reagents to diffuse into the plate
- Incubate your plate for a longer period to ensure full color development
Check the genotype of the cell strain you are using. Our Gateway destination vectors typically contain a ccdB cassette, which, if uninterrupted, will inhibit E. coli growth. Therefore, un-cloned vectors should be propagated in a ccdB survival cell strain, such as our ccdB Survival 2 T1R competent cells.
While there is no specific strain that works better with large plasmids, it is important to focus on transformation efficiency. For larger plasmids, chemically competent cells with highest efficiency are suggested, such as OmniMAX 2, TOP10, etc. We would recommend using an electrocompetent cell strain with plasmids larger than 20 kb for best efficiency.
With any strain, the first thing to try would be to lower the growth temperature of the culture to 30 degrees C or even lower (room temperature). Slower growth will generally allow E. coli to tolerate difficult sequences better. If reducing the growth temperature doesn't help, you may want to consider using a competent cell strain such as Stbl2 or Stbl4 cells, which have been shown to accommodate this type of sequence better than other strains in the same conditions.
We recommend trying the following:
- Carry out the puc19 transformation control; this gives you information about the performance of the cells.
- Check plates for expiration and correct media used (LB/agar).
- Confirm that the correct antibiotic and concentration was used.
The F' episome in TOP10F' has a lacIq marker, which over-expresses the lac repressor. IPTG must be added to LB plates along with X-gal to see beta-galactosidase expression and blue color in this strain. TOP10, on the other hand, does not require IPTG for blue/white screening.
There are a few conditions that can lead to this: SOC medium or other media used when plating was contaminated, DNA was contaminated with amp-resistant microbes, you used old plates with degraded amp, or the competent cells themselves were contaminated.
If you are using a mcr/mrr(+) competent cell strain, cellular enzymes may be recognizing eukaryotic methylation patterns on the yeast genomic DNA and deleting or rearranging it. Try a mcr/mr(-) strain such as Top10, DH10B, or OmniMAX 2.
XbaI cutting site is a Dam-methylation sensitive restriction site. TOP10 is a dam(+) strain, which means it expresses the methylating enzyme, Dam. You can try re-transforming into a dam(-) strain, such as INV110. Other dam- (and dcm-) sensitive restriction sites include the following:
- Dam: Bcl I, Cla I, Hph I, Mbo I, Mbo II, Taq I, Xba I, BspH I, Nde II, Nru I
- Dcm: Ava II, EcoO 109 I, EcoR II, Sau96 I, ScrF, Stu I, Aat I, Apa I, Bal I, Kpn I, ISfi I
1. Use pUC or pUC-based vectors that contain the portion of the lacZ gene that allows for ? complementation.
2. Select an E. coli strain that carries the lacZdeltaM15 marker.
3. Plate transformations on plates containing X-gal. Spread 50 µg of 2% X-gal or 100 microliters of 2% bluo-gal (both can be dissolved in DMF or 50:50 mixture of DMSO:water) on the surface of a 100 mm plate and let dry. Alternatively, add directly to the cooled medium (~50 degrees C) before pouring the plates at a final concentration of 50 µg/mL for X-gal and 300 µg/mL for bluo-gal. Plates are stable for 4 weeks at 4 degrees C.
4. If the strain used carries the lacIq marker, add IPTG to induce the lac promoter. Spread 30 µl of 100 mM IPTG (in water) on 100 mm plates. Alternatively, add the IPTG directly to cooled medium (~50 degrees C) before pouring the plates to a final concentration of 1 mM. Plates are stable for 4 weeks at 4 degrees C.
5. Do not plate E. coli on medium containing glucose if using X-gal or bluo-gal for blue-white screening. Glucose competes as a substrate and prevents cells from turning blue.
For long-term storage, preparation of glycerol stocks stored at -70 degrees C is recommended. Follow the protocol below:
1. Pick one colony into 5 mL LB broth or S.O.C. medium. Grow overnight at 37 degrees C.
2. Prepare glycerol solution: 6 mL of S.O.B. medium and 4 mL of glycerol.
3. Take one volume of cells and add one volume of glycerol solution and mix.
4. Freeze in ethanol/dry ice. Store at -70 degrees C.
Yes, this is possible. We recommend using saturating amounts of DNA (10 ng of each plasmid). Make sure that the origin of replication is different in each plasmid so that they can both be maintained in the cell. If the ori is the same, the plasmids will compete for replication and the one with even a slight disadvantage will be lost. Alternatively, cells with a resident plasmid can be electroporated with a second plasmid without electrocuring taking place.
In plates, we recommend 50 µg/mL X-gal and 1 mM IPTG (0.24 mg/mL). When spreading directly onto agar plates, we recommend 40-50 µl of 40 mg/mL X-gal (2% stock) in dimethylformamide and 30-40 µl of 100 mM IPTG on top of the agar. Let the X-gal and IPTG diffuse into the agar for approximately 1 hour. Do not plate on media containing glucose, as it competes with X-gal or bluo-gal and prevents cells from turning blue.
Competent cell efficiency is measured by transformation efficiency. Transformation efficiency is equal to the number of transformants, or colony forming units, per microgram of plasmid DNA (cfu/microgram).
Some suggestions that will help you to obtain the highest transformation efficiency are:
- Thaw competent cells on ice instead of room temperature; do not vortex cells.
- Add DNA to competent cells once thawed.
- Ensure that the incubation times are followed as outlined in the competent cell protocol for the strain you are working with; changes in the length of time can decrease efficiency.
- Remove salts and other contaminants from your DNA sample; DNA can be purified before transformation using a spin column, or phenol/chloroform extraction and ethanol precipitation can be employed.
DH5? cells are commonly used for routine cloning, but are mcr/mrr+, and therefore not recommended for genomic cloning. The TOP10 competent cells, on the other hand, contain mutated mcr/mrr, and therefore are a good choice for routine cloning and can be used for cloning of methylated DNA, such as eukaryotic genomic DNA. Our Mach1 strain is the fastest growing cloning strain that is T1 phage resistant.
These small colonies are most likely caused by degradation of the Ampicillin. The colonies are just untransformed cells that grow on LB with degraded Amp. In order to circumvent this scenario, you can try to:
1. Plate cells at a lower density
2. Use fresh LB-Amp plates or replace Ampicillin with carbenicillin.
3. The plates should not be incubated for more than 20 hours at 37 degrees C. Beta-lactamase, the enzyme produced from the Ampicillin-resistance gene, is secreted from the Amp-resistant transformants and inactivates the antibiotic in the area surrounding the transformant colony. This inactivation of the selection agent allows satellite colonies (which are not truly Amp-resistant) to grow. This is also true if carbenicillin is being used.
One possible explanation could be toxicity associated with the insert. This toxicity does not affect slow growing cells on solid medium but is much stronger in faster growth conditions like liquid medium.
Suggestions:
1. Use TOP10F' or any other strain with the LacIq repressor
2. Try using any other strain appropriate for cloning.
3. Lower growth temperature to 27 - 30 degrees C and grow the culture longer
4. Another possibility to explain lack of growth is possible phage contamination. In this situation we recommend using an E. coli strain that is T1 phage resistant like DH5alpha-T1R.
This may be caused by the instability of the insert DNA in TOP10 E. Coli. In this case, E.coli strains such as Stbl2, Stbl3, or Stbl4 have been shown to support the propagation of DNA with multiple repeats, retroviral sequences, and DNA with high GC content better than other strains.
Some possible causes and remedies are:
- Ligase function is poor. Check the age of the ligase and function of the buffer.
- Competent cells are not transforming. Test the efficiency of the cells with a control supercoiled vector, such as puc19.
- Both molecules were de-phosphorylated.
- Inhibition of ligation by restriction enzymes and residual buffer. Try transformation of uncut vector, clean up restriction with phenol, or carry out PCR cleanup/gel extraction before ligation.
- Incorrect antibiotic selection used. Check the plasmid and plates and make sure concentration of antibiotic used is correct.
If nothing above applies, low to no colonies may be due to instability of the insert DNA in your competent cells. In this case, E. coli strains such as Stbl2, Stbl3, or Stbl4 have been shown to support the propagation of DNA with multiple repeats, retroviral sequences, and DNA with high GC content better than other strains.
If working with a vector that contains the lac promoter and the LacZ ? fragment (for ? complementation), blue/white screening can be used as a tool to select for presence of the insert. X-gal is added to the plate as a substrate for the LacZ enzyme and must always be present for blue/white screening. The minimum insert size needed to completely disrupt the lacZ gene is >400 bp. If the LacIq repressor is present (either provided by the host cells, for example TOP10F', or expressed from the plasmid), it will repress expression from the lac promoter thus preventing blue/white screening. Hence, in the presence of the LacIq repressor, IPTG must be provided to inhibit the LacIq. Inhibition of LacIq permits expression from the lac promoter for blue/white screening.
TOPO vectors containing the LacZ-ccdB cassette allow direct selection of recombinants via disruption of the lethal E. coli gene, ccdB. Ligation of a PCR product disrupts expression of the LacZ-ccdB gene fusion permitting growth of only positive recombinants upon transformation. Cells that contain non-recombinant vector are killed upon plating. Therefore, blue/white screening is not required. When doing blue/white color screening of clones in TOPO vectors containing the LacZ-ccdB cassette, colonies showing different shades of blue may be observed. It is our experience that those colonies that are light blue as well as those that are white generally contain inserts. The light blue is most likely due to some transcription initiation in the presence of the insert for the production of the lacZ alpha without enough ccdB expressed to kill the cells and is insert dependent. To completely interrupt the lacZ gene, inserts must be >400 bp; therefore an insert of 300 bp can produce a light blue colony. A white colony that does not contain an insert is generally due to a spontaneous mutation in the ccdB gene.
A minimum insertion of 150 bp is needed in order to ensure disruption of the ccdB gene and prevent cell death. (Reference: Bernard et al., 1994. Positive-selection vectors using the F plasmid ccdB killer gene. Gene 148: 71-74.)
Strains that contain an F plasmid, such as TOP10F', are not recommended for transformation and selection of recombinant clones in any TOPO vector containing the ccdB gene. The F plasmid encodes the CcdA protein, which acts as an inhibitor of the CcdB gyrase-toxin protein. The ccdB gene is also found in the ccd (control of cell death) locus on the F plasmid. This locus contains two genes, ccdA and ccdB, which encode proteins of 72 and 101 amino acids respectively. The ccd locus participates in stable maintenance of F plasmid by post-segregational killing of cells that do not contain the F plasmid. The CcdB protein is a potent cell-killing protein when the CcdA protein does not inhibit its action.
If working with a vector that contains the lac promoter and the LacZ alpha fragment (for ? complementation), blue/white screening can be used as a tool to select for presence of the insert. X-gal is added to the plate as a substrate for the LacZ enzyme and must always be present for blue/white screening. The minimum insert size needed to completely disrupt the lacZ gene is >400 bp. If the LacIq repressor is present (either provided by the host cells, for example TOP10F', or expressed from the plasmid) it will repress expression from the lac promoter, thus preventing blue/white screening. Hence in the presence of the LacIq repressor, IPTG must be provided to inhibit the LacIq. Inhibition of LacIq permits expression from the lac promoter for blue/white screening. X-gal (also known as 5-bromo-4-chloro-3-indolyl β-D-glucopyranoside) is soluble in DMSO or DMF, and can be stored in solution in the freezer for up to 6 months. Protect the solution from light. Final concentration of X-gal and IPTG in agar plates: Prior to pouring plates, add X-gal to 20 mg/mL and IPTG to 0.1 mM to the medium. When adding directly on the surface of the plate, add 40 µl X-gal (20 mg/mL stock) and 4 µl IPTG (200 mg/mL stock).
No, these vectors do not contain a functional promoter to express your gene of interest. These vectors are typically for subcloning or sequencing.
TA Cloning:
- This cloning method was designed for use with pure Taq polymerases (native, recombinant, hot start); however, High Fidelity or Taq blends generally work well with TA cloning. A 10:1 or 15:1 ratio of Taq to proofreader polymerase will still generate enough 3' A overhangs for TA cloning.
- Recommended polymerases include Platinum Taq, Accuprime Taq, Platinum or Accuprime Taq High Fidelity, AmpliTaq, AmpliTaq Gold, or AmpliTaq Gold 360.
Blunt cloning:
- Use a proofreading enzyme such as Platinum SuperFi DNA Polymerase.
Directional TOPO cloning:
- Platinum SuperFi DNA Polymerase works well.
LR Clonase II Plus contains an optimized formulation of recombination enzymes for use in MultiSite Gateway LR reactions. LR Clonase and LR Clonase II enzyme mixes are not recommended for MultiSite Gateway LR recombination reactions, but LR Clonase II Plus is compatible with both multi-site and single-site LR recombination reactions.
For the Directional TOPO Cloning Vectors, a PCR product must be generated by a proofreading enzyme to create a blunt product. Pfx50 or Accuprime Pfx and Accuprime Pfx Supermix from Thermo Fisher Scientific are recommended for use.
When cloning a Pfx-amplified PCR product, the insert to vector ratio is an important consideration. The PCR product generally needs to be diluted since Pfx generates a high concentration of product and using too much insert DNA can hamper the TOPO reaction. A 1:1 molar ratio of vector to insert (or about 2-10ng of insert) is recommended.
When the LR reaction is complete, the reaction is stopped with Proteinase K and transformed into E. coli resulting in an expression clone containing a gene of interest. A typical LR reaction followed by Proteinase K treatment yields about 35,000 to 150,000 colonies per 20ul reaction. Without the Proteinase K treatment, up to a 10 fold reduction in the number of colonies can be observed. Despite this reduction, there are often still enough colonies containing the gene of interest to proceed with your experiment, so the Proteinase K step can be left out after the LR reaction is complete if necessary.
If you wish to use a polymerase mixture containing Taq polymerase and a proofreading polymerase, Taq must be used in excess with a 10:1 ratio of Taq to the proofreading enzyme to ensure the presence of 3´ A-overhangs on the PCR product. If you use polymerase mixtures that do not have enough Taq polymerase or a proofreading polymerase only, you can add 3' A-overhangs following PCR. See the vector product manuals for details.
Some examples of Taq blends that are compatible with TOPO TA Cloning are Platinum Taq DNA Polymerase High Fidelity and AccuPrime Taq DNA Polymerase High Fidelity.
Taq polymerase has a non-template-dependent terminal transferase activity that adds a single deoxyadenosine (A) to the 3´ ends of PCR products. The linearized vector supplied in our TA Cloning kits have single, overhanging 3´ deoxythymidine (T) residues. This allows PCR inserts to ligate efficiently with the vector.
Assuming that the primer is at a 50 nM final concentration and 50 mM final salt concentration, the melting temperatures are: M13 Forward (-20) Primer = 52.7 and the M13 Reverse Primer = 45.3. For use in the control PCR reaction we recommend using an annealing temperature of 56C.
In most cases, there will not be enough pENTR vector DNA present to go directly from TOPO cloning into an LR reaction. You need between 100-300 ng of pENTR vector for an efficient LR reaction, and miniprep of a colony from the TOPO transformation is necessary to obtain that much DNA. However, if you want to try it, here are some recommendations for attempting to go straight into LR reactions from the TOPO reaction using pENTR/D, or SD TOPO, or pCR8/GW/TOPO vectors:
1. Heat inactivate the topoisomerase after the TOPO cloning reaction by incubating the reaction at 85 degrees C for 15 minutes.
2. Use the entire reaction (6 µL) in the LR clonase reaction. No purification steps are necessary.
3. Divide the completed LR reaction into 4 tubes and carry out transformations with each tube. You cannot transform entire 20 µL reaction in one transformation, and we have not tried ethanol precipitation and then a single transformation.
When attempting this protocol, we observed very low efficiencies (~10 colonies/plate). So just be aware that while technically possible, going directly into an LR reaction from a TOPO reaction is very inefficient and will result in a very low colony number, if any at all.
To have an N-terminal tag, the gene of interest must be in the correct reading frame when using non-TOPO adapted Gateway entry vectors. All TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame, and to add the N-terminal tag you simply recombine with a destination vector that has N-terminal tag.
To attach a C-terminal tag to your gene of interest, the insert must lack its stop codon, and be in the correct reading frame for compatibility with our C-terminal tagged destination vectors. Again, TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame. If you do not want the C-terminal tag to be expressed, simply include a stop codon at the end of the insert that is in frame with the initial ATG.
Generally, you need to choose a destination vector before you design and clone your insert into the Entry vector. This will determine whether you need to include an initiating ATG or stop codon with your insert.
No, not directly. The attB-PCR product must first be cloned, via a BP Clonase reaction, into a pDONR vector which creates an "Entry Clone" with attL sites. This clone can then be recombined, via an LR Clonase reaction, with a Destination vector containing attR sites. However, It is possible to perform both of these reactions in one step using the "One-Tube Protocol" described in the manual entitled "Gateway Technology with Clonase II".
Yes, this can be done using the Multisite Gateway Technology. MultiSite Gateway Pro Technology enables you to efficiently and conveniently assemble multiple DNA fragments - including genes of interest, promoters, and IRES sequences - in the desired order and orientation into a Gateway Expression vector. Using specifically designed att sites for recombinational cloning, you can clone two, three, or four DNA fragments into any Gateway Destination vector containing attR1 and attR2 sites. The resulting expression clone is ready for downstream expression and analysis applications.
For the BP reaction, approximately 5-10% of the starting material is converted into product. For the LR reaction, approximately 30% of the starting material is converted into product.
The core region of the att sites contains the recognition sequence for the restriction enzyme BsrGI. Provided there are no BsrGI sites in the insert, this enzyme can be used to excise the full gene from most Gateway plasmids. The BsrGI recognition site is 5'-TGTACA and is found in both att sites flanking the insertion site.
If a different restriction site is desired, the appropriate sequence should be incorporated into your insert by PCR.
We do have an alternative method called the "attB Adapter PCR" Protocol in which you make your gene specific primer with only 12 additional attB bases and use attB universal adapter primers. This protocol allows for shorter primers to amplify attB-PCR products by utilizing four primers instead of the usual two in a PCR reaction. You can find the sequence of these primers in the protocol on page 45 of the "Gateway Technology with Clonase II" manual.
There is a protocol in which all 4 primers mentioned above are in a single PCR reaction. You can find this protocol at in the following article: Quest vol. 1, Issue 2, 2004. https://www.thermofisher.com/us/en/home/references/newsletters-and-journals/quest-archive.reg.in.html. The best ratio of the first gene-specific and the second attB primers was 1:10.
We do not offer pre-made primers, but we can recommend the following sequences that can be ordered as custom primers for sequencing of pDONR201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC
1. Yeast two-hybrid protein-protein interaction studies Walhout AJ, Sordella R, Lu X, Hartley JL, Temple GF, Brasch MA, Thierry-Mieg N, Vidal M.
2. Protein Interaction Mapping in C. elegans Using Proteins Involved in Vulval Development. Science Jan 7th 2000; 287(5450), 116-122 Davy, A. et al.
3. A protein-protein interaction map of the Caenorhabditis elegans 26S proteosome. EMBO Reports (2001) 2 (9), p. 821-828. Walhout, A.J.M. and Vidal, M. (2001).
4. High-throughput Yeast Two-Hybrid Assays for Large-Scale Protein Interaction mapping. Methods: A Companion to Methods in Enzymology 24(3), pp.297-306
5. Large Scale Analysis of Protein Complexes Gavin, AC et al. Functional Organization of the Yeast Proteome by Systematic Analysis of Protein Complexes. Nature Jan 10th 2002, 415, p. 141-147.
6. Systematic subcellular localisation of proteins Simpson, J.C., Wellenreuther, R., Poustka, A., Pepperkok, R. and Wiemann, S.
7. Systematic subcellular localization of novel proteins identified by large-scale cDNA sequencing. EMBO Reports (2000) 1(3), pp. 287-292.
8. Protein-over expression and crystallography Evdokimov, A.G., Anderson, D.E., Routzahn, K.M. & Waugh, D.S.
9. Overproduction, purification, crystallization and preliminary X-ray diffraction analysis of YopM, an essential virulence factor extruded by the plague bacterium Yersinia pestis. Acta Crystallography (2000) D56, 1676-1679.
10. Evdokimov, et al. Structure of the N-terminal domain of Yersinia pestis YopH at 2.0 A resolution. Acta Crystallographica D57, 793-799 (2001).
11. Lao, G. et al. Overexpression of Trehalose Synthase and Accumulation of Intracellular Trehalose in 293H and 293FTetR:Hyg Cells. Cryobiology 43(2):106-113 (2001).
12. High-throughput cloning and expression Albertha J. M. Walhout, Gary F. Temple, Michael A. Brasch, James L. Hartley, Monique A. Lorson, Sander Van Den Huevel, and Marc Vidal.
13. Gateway Recombinational Cloning: Application to the Cloning of Large Numbers of Open Reading Frames or ORFeomes. Methods in Enzymology, Vol. 328, 575-592.
14. Wiemann, S. et.al., Toward a Catalog of Human Genes and Proteins: Sequencing and Analysis of 500 Novel Complete Protein Coding Human cDNAs, Genome Research (March 2001) Vol. 11, Issue 3, pp.422-435
15. Reviewed in NATURE: Free Access to cDNA provides impetus to gene function work. 15 march 2001, p. 289. Generating directional cDNA libraries using recombination
16. Osamu Ohara and Gary F. Temple. Directional cDNA library construction assisted by the in vitro recombination reaction. Nucleic Acids Research 2001, Vol. 29, no. 4. RNA interference (RNAi)
17. Varsha Wesley, S. et al. Construct design for efficient, effective and highthroughput gene silencing in plants. The Plant Journal 27(6), 581-590 (2001). Generation of retroviral constructs
18. Loftus S K et al. Generation of RCAS vectors useful for functional genomic analyses. DNA Res 31;8(5):221 (2001).
19. James L. Hartley, Gary F. Temple and Michael A. Brasch. DNA Cloning Using In Vitro Site-Specific Recombination. Genome Research (2000) 10(11), pp. 1788-1795.
20. Reboul et al. Open-reading frame sequence tags (OSTs) support the existence of at least 17,300 genes in C. elegans. Nature Genetics 27(3):332-226 (2001).
21. Kneidinger, B. et al. Identification of two GDP-6-deoxy-D-lyxo-4-hexulose reductase synthesizing GDP-D-rhamnose in Aneurinibacillus thermoaerophilus L420-91T*. JBC 276(8) (2001).
The attP1 sequence (pDONR) is:
AATAATGATT TTATTTTGAC TGATAGTGAC CTGTTCGTTG CAACAAATTG ATGAGCAATGCTTTTTTAT AATGCCAACT TTGTACAAAA AAGC[TGAACG AGAAACGTAA AATGATATAA ATATCAATAT ATTAAATTAG ATTTTGCATA AAAAACAGACTA CATAATACTG TAAAACACAA CATATCCAGT CACTATGAAT CAACTACTTA GATGGTATTA GTGACCTGTA]
The region within brackets is where the site is "cut" and replaced by the attB1-fragment sequence to make an attL1 site. The sequence GTACAAA is the overlap sequence present in all att1 sites and is always "cut" right before the first G.
The overlap sequence in attP2 sites is CTTGTAC and cut before C. This is attP2:
ACAGGTCACT AATACCATCT AAGTAGTTGA TTCATAGTGA CTGGATATGT TGTGTTTTAC AGTATTATGT AGTCTGTTTT TTATGCAAAA TCTAATTTAA TATATTGATA TTTATATCAT TTTACGTTTC TCGTTCAGCT TTCTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT AATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT
So, attL1 (Entry Clone) should be:
A ATAATGATTT TATTTTGACT GATAGTGACC TGTTCGTTGC AACAAATTGA TGAGCAATGC TTTTTTATAA TGCCAACT TT G TAC AAA AAA GC[A GGC T]NN NNN
attL2 (Entry Clone) should be:
NNN N[AC C]CA GCT TT CTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT CAATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT
The sequence in brackets comes from attB, and N is your gene-specific sequence.
Note: When creating an Entry Clone through the BP reaction and a PCR product, the vector backbone is not the same as Gateway Entry vectors. The backbone in the case of PCR BP cloning is pDONR201.
There is no size restriction on the PCR fragments if they are cloned into a pDONR vector. The upper limit for efficient cloning into a TOPO adapted Gateway Entry vector is approximately 5 kb. A Gateway recombination reaction can occur between DNA fragments that are as large as 150 kb.
Destination vectors that contain N-terminal fusion partners will express proteins that contain amino acids contributed from the attB1 site, which is 25 bases long. This means that in addition to any tag (6x His and/or antibody epitope tag), the N-terminus of an expressed protein will contain an additional 9 amino acids from the attB1 sequence - the typical amino acid sequence is Thr-Ser-Leu-Tyr-Lys-Lys-Ala-Gly-nnn, where nnn will depend on the codon sequence of the insert.
Effects on protein function: A researcher (Simpson et al. EMBO Reports 11(31):287-292, 2000) demonstrated that GFP fusions (N- terminal and C-terminal) localized to the proper intracellular compartment. The expression constructs were generated using Gateway cloning, so the recombinant protein contained the attB1 or attB2 amino acid sequence. The localization function of the cloned recombinant proteins was preserved.
Effects on expression: We have seen no effect of the attB sites on expression levels in E. coli, insect and mammalian cells. The gus gene was cloned into bacterial expression vectors (for native and N-terminal fusion protein expression) using standard cloning techniques and expressed in bacteria. Gus was also cloned into Gateway Destination vectors (for native and N-terminal fusion expression) and expressed. When protein expression is compared, there was no difference in the amount of protein produced. This demonstrates that for this particular case, the attB sites do not interfere with transcription or translation.
Effects on solubility: A researcher at the NCI has shown that Maltose Binding Protein fusions constructed with Gateway Cloning were soluble. The fusion proteins expressed had the attB amino acid sequence between the Maltose Binding Protein and the cloned protein. It is possible that some proteins containing the attB sequence could remain insoluble when expressed in E.coli.
Effects on folding: Two Hybrids screens show the same interacters identified with and without the attB sequence. Presumably correct protein folding would be required for protein-protein interactions to take place. It is possible that some proteins containing the attB sequence may not fold correctly.
Since the attB sequences are on the 5' end of oligos, they will not anneal to the target template in the first round of PCR. Sometimes the PCR product is more specific with the attB primers, probably due to the longer annealing sequence (all of attB plus gene specific sequence) after the first round of amplification. Generally there is no need to change PCR reaction conditions when primers have the additional attB sequence
No, this is not really feasible due to the fact that the attL sequence is approximately 100 bp, which is too long for efficient oligo synthesis. Our own maximum sequence length for ordering custom primers is 100 nucleotides. In contrast, the attB sequences are only 25 bp long, which is a very reasonable length for adding onto the 5' end of gene-specific PCR primers.
Vector information can be found in the product manuals or directly on our web site by entering the catalog number of the product in the search box. The vector map, cloning site diagram, and sequence information will be linked to the product page.
The Gateway nomenclature is consistent with lambda nomenclature, but we use numbers to differentiate between modified versions of the att sites (attB1, attB2, attP1, attP2, and so on). We have introduced mutations in the att sites to provide specificity and directionality to the recombination reaction. For example, attB1 will only recombine with attP1 and not with attP2.
The first step is to create an Entry clone for your gene of interest. We have 3 options to do this: The first is by BP recombination reaction using the PCR Cloning System with Gateway Technology. This is recommended for cloning large (>5 kb) PCR products. We also have Gateway compatible TOPO Cloning vectors such as pCR8/GW/TOPO and pENTR/D-TOPO. The final option is to use restriction enzymes to clone into a pENTR Dual Selection vector.
The gene of interest must be flanked by the appropriate att sites, either attL (100 bp) in an Entry clone or attB (25 bp) in a PCR product. For Entry clones, everything between the attL sites will be shuttled into the Gateway destination vector containing attR sites, and a PCR product flanked by attB sites must be shuttled into an attP-containing donor vector such as pDONR221.
The location of translation initiation sites, stop codons, or fusion tags for expression must be considered in your initial cloning design. For example, if your destination vector contains an N-terminal tag but does not have a C-terminal tag, the vector should already contain the appropriate translation start site but the stop codon should be included in your insert.
Yes, increasing the incubation time from 1 hour to 4 hours will generally increase colony numbers 2-3 fold. An overnight incubation at room temperature will typically increase colony yield by 5-10 fold.
BP Clonase II and LR Clonase II can be freeze/thawed at least 10 times without significant loss of activity. However, you may still want to aliquot the enzymes to keep freeze/thaw variability to a minimum.
These enzymes are more stable than the original BP and LR Clonase and can be stored at -20 degrees C for 6 months.
Mini-prep (alkaline lysis) DNA preparations work well in Gateway cloning reactions. It is important that the procedure remove contaminating RNA for accurate quantification. Plasmid DNA purified with our S.N.A.P. nucleic acid purification kits, ChargeSwitch kits, or PureLink kits are recommended.
A simple way to express a protein with a leader sequence is to have the leader sequence encoded in the destination vector. The other option is to have the leader sequence subcloned into the entry vector using restriction enzymes, or incorporate the leader sequence into the forward PCR primer when cloning a PCR product into the entry vector. Please see Esposito et al. (2005), Prot. Exp. & Purif. 40, 424-428 for an example of how a partial leader sequence for secretion was incorporated into an entry vector.
This depends on whether you are expressing a fusion or a native protein in the Gateway destination vector. For an N-terminal fusion protein the ATG will be given by the destination vector and it will be upstream of the attB1 site. For a C-terminal fusion protein or a native protein, the ATG should be provided by your gene of interest, and it will be downstream of the attB1 site.
The Gateway attB sites are derived from the bacteriophage lambda site-specific recombination, but are modified to remove stop codons and reduce secondary structure. The core regions have also been modified for specificity (i.e., attB1 will recombine with attP1 but not with attP2).
Expression experiments have shown that the extra amino acids contributed by the attB site to a fusion protein will most likely have no effect on protein expression levels or stability. In addition, they do not appear to have any effect on two-hybrid interactions in yeast. However, as is true with the addition of any extra sequences that result from tags, the possible effects will be protein-dependent.
No, attB primers are highly specific under standard PCR conditions. We have amplified from RNA (RT-PCR), cDNA libraries, genomic DNA, and plasmid templates without any specificity problems.
The smallest size we have recombined is a 70 bp piece of DNA located between the att sites. Very small pieces are difficult to clone since they negatively influence the topology of the recombination reaction.
There is no theoretical size limitation. PCR products between 100 bp and 11 Kb have been readily cloned into a pDONR Gateway vector. Other DNA pieces as large as 150 kb with att sites will successfully recombine with a Gateway-compatible vector. Overnight incubation is recommended for large inserts.
Standard desalted purity is generally sufficient for creating attB primers. We examined HPLC-purified oligos for Gateway cloning (about 50 bp long) and found only about a 2-fold increase in colony number over standard desalted primers. If too few colonies are obtained, you may try to increase the amount of PCR product used and/or incubate the BP reaction overnight.
Our vectors have not been completely sequenced. Your sequence data may differ when compared to what is provided. Known mutations that do not affect the function of the vector are annotated in public databases.
No, our vectors are not routinely sequenced. Quality control and release criteria utilize other methods.
Sequences provided for our vectors have been compiled from information in sequence databases, published sequences, and other sources.