Search
Search
View additional product information for Myc Tag Monoclonal Antibody - FAQs (R950CUS, R95025)
3 product FAQs found
ELISA, Western blot, Immunoprecipitation, Immunofluorescence, and Immunohistochemistry protocols have all been used successfully with our epitope tag antibodies. Please consult the product manuals for specific protocols and dilutions.
Find additional tips, troubleshooting help, and resources within our Protein Assays and Analysis Support Center.
Below is a comparison of the anti-myc epitope and the homologous regions in mouse and chicken myc.
human c-myc: E Q K L I S E E D L (immunogen)
mouse c-myc: E H K L T S E E D L
chicken c-myc: E H R L I A E K E Q
chicken v-myc: E H K L I A E K E Q
According to the following paper describing our Anti-myc antibody, it only weakly recognizes murine c-myc and does not recognize chicken forms of c-myc or v-myc: Evan et al. (1985) MCB 5:3610-3616
Find additional tips, troubleshooting help, and resources within our Protein Assays and Analysis Support Center.
The DNA sequence of the Anti-myc antibody epitope is: GAACAAAAACTCATCTCAGAAGAGGATCTGAAT
Find additional tips, troubleshooting help, and resources within our Protein Assays and Analysis Support Center.