Product Details

SNP ID: rs142133113
Assay Type: Functionally tested
NCBI dbSNP Submissions: 3
Location: Chr.1:1232687 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTACGAAAACCTCACGGCCAAGGTG[C/G]TGGCCATGCTGGCCTGGCTGGACGA
Phenotype: MIM: 615291 MIM: 616593 MIM: 614282
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: B3GALT6 PubMed Links

Gene Details

Gene: B3GALT6
Gene Name: beta-1,3-galactosyltransferase 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_080605.3	439	Missense Mutation	CTG,GTG	L137V	NP_542172.2

Gene: FAM132A
Gene Name: family with sequence similarity 132 member A

There are no transcripts associated with this gene.

Gene: SDF4
Gene Name: stromal cell derived factor 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016176.3	439	Intron			NP_057260.2
NM_016547.2	439	Intron			NP_057631.1
XM_011541556.1	439	Intron			XP_011539858.1

View Full Product Details