Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTACGAAAACCTCACGGCCAAGGTG[C/G]TGGCCATGCTGGCCTGGCTGGACGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 615291 MIM: 616593 MIM: 614282 | ||||||||||||||||||||
Literature Links: |
B3GALT6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
B3GALT6 - beta-1,3-galactosyltransferase 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_080605.3 | 439 | Missense Mutation | CTG,GTG | L,V 137 | NP_542172.2 |
FAM132A - family with sequence similarity 132 member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SDF4 - stromal cell derived factor 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016176.3 | 439 | Intron | NP_057260.2 | |||
NM_016547.2 | 439 | Intron | NP_057631.1 | |||
XM_011541556.1 | 439 | Intron | XP_011539858.1 |