Product Details

SNP ID: rs61751956
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:50517646 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAGGTTCGTGGATGGAGTTGAGGCC[A/G]GGCGGGCCTTTGCCCCCGCAGCCCC
Phenotype: MIM: 615324
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ASPDH PubMed Links

Gene Details

Gene: ASPDH
Gene Name: aspartate dehydrogenase domain containing

There are no transcripts associated with this gene.

Gene: JOSD2
Gene Name: Josephin domain containing 2

There are no transcripts associated with this gene.

Gene: LRRC4B
Gene Name: leucine rich repeat containing 4B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001080457.1	2383	Silent Mutation	CCC,CCT	P689P	NP_001073926.1
XM_005259429.4	2383	Silent Mutation	CCC,CCT	P689P	XP_005259486.1
XM_006723506.3	2383	Silent Mutation	CCC,CCT	P689P	XP_006723569.1
XM_011527520.2	2383	Silent Mutation	CCC,CCT	P689P	XP_011525822.1

View Full Product Details