Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Enterprise Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C____904973_10
          See other APOC1 GT Assays ›
          SNP ID:
          rs7412
          Gene
          APOC1 APOE TOMM40
          Gene Name
          apolipoprotein C1
          apolipoprotein E
          translocase of outer mitochondrial membrane 40
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.19: 44908822 - 44908822 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          CCGCGATGCCGATGACCTGCAGAAG[C/T]GCCTGGCAGTGTACCAGGCCGGGGC

          Assay ID C____904973_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 107710 MIM: 107741 MIM: 608061

          Literature Links:

          APOC1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.08)
          (0.92)
          Caucasian
          T (0.02)
          (0.98)
          CEPH (CEU) - Not Available
          EAS
          T (0.10)
          (0.90)
          African American
          T (0.13)
          (0.87)
          YRI (Yoruba)
          T (0.10)
          (0.90)
          SAS
          T (0.04)
          (0.96)
          Japanese
          T (0.10)
          (0.90)
          JPT (Japanese)
          T (0.05)
          (0.95)
          AFR
          T (0.10)
          (0.90)
          Chinese
          T (0.07)
          (0.93)
          CHB (Han Chinese)
          T (0.10)
          (0.90)
          EUR
          T (0.06)
          (0.94)
          AMR
          T (0.05)
          (0.95)
          APOC1 - apolipoprotein C1
          There are no transcripts associated with this gene.
          APOE - apolipoprotein E
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000041.3 724 Missense Mutation CGC,TGC R,C 176 NP_000032.1
          NM_001302688.1 724 Missense Mutation CGC,TGC R,C 202 NP_001289617.1
          NM_001302689.1 724 Missense Mutation CGC,TGC R,C 176 NP_001289618.1
          NM_001302690.1 724 Missense Mutation CGC,TGC R,C 176 NP_001289619.1
          NM_001302691.1 724 Missense Mutation CGC,TGC R,C 176 NP_001289620.1
          TOMM40 - translocase of outer mitochondrial membrane 40
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Panther Classification:

          Molecular Function -

          apolipoprotein

          Gene Ontology Categories:

          Function(s) Process(es)

          response to reactive oxygen species
          retinoid metabolic process
          negative regulation of endothelial cell proliferation
          response to dietary excess
          triglyceride metabolic process
          cholesterol catabolic process
          cellular calcium ion homeostasis
          receptor-mediated endocytosis
          cytoskeleton organization
          G-protein coupled receptor signaling pathway
          nitric oxide mediated signal transduction
          synaptic transmission, cholinergic
          cholesterol metabolic process
          regulation of gene expression
          negative regulation of platelet activation
          positive regulation of cholesterol esterification
          positive regulation of cholesterol efflux
          long-chain fatty acid transport
          protein import
          virion assembly
          triglyceride catabolic process
          cGMP-mediated signaling
          negative regulation of blood coagulation
          regulation of axon extension
          positive regulation of cGMP biosynthetic process
          neuron projection regeneration
          regulation of Cdc42 protein signal transduction
          positive regulation of low-density lipoprotein particle receptor catabolic process
          cholesterol efflux
          phospholipid efflux
          very-low-density lipoprotein particle remodeling
          low-density lipoprotein particle remodeling
          high-density lipoprotein particle remodeling
          high-density lipoprotein particle assembly
          chylomicron remnant clearance
          high-density lipoprotein particle clearance
          very-low-density lipoprotein particle clearance
          lipoprotein metabolic process
          lipoprotein biosynthetic process
          lipoprotein catabolic process
          vasodilation
          cholesterol homeostasis
          negative regulation of MAP kinase activity
          negative regulation of neuron apoptotic process
          negative regulation of blood vessel endothelial cell migration
          reverse cholesterol transport
          positive regulation by host of viral process
          negative regulation of cholesterol biosynthetic process
          positive regulation of lipid biosynthetic process
          intracellular transport
          regulation of neuronal synaptic plasticity
          artery morphogenesis
          negative regulation of inflammatory response
          positive regulation of nitric-oxide synthase activity
          positive regulation of membrane protein ectodomain proteolysis
          maintenance of location in cell
          fatty acid homeostasis
          positive regulation of dendritic spine development
          negative regulation of canonical Wnt signaling pathway
          AMPA glutamate receptor clustering
          NMDA glutamate receptor clustering
          cellular oxidant detoxification
          regulation of beta-amyloid clearance
          negative regulation of neuron death
          positive regulation of postsynaptic membrane organization
          negative regulation of presynaptic membrane organization
          negative regulation of beta-amyloid formation
          positive regulation of dendritic spine maintenance
          positive regulation of phospholipid efflux
          positive regulation of lipid transport across blood brain barrier
          beta-amyloid binding
          lipid transporter activity
          protein binding
          phospholipid binding
          heparin binding
          lipid binding
          cholesterol binding
          antioxidant activity
          cholesterol transporter activity
          identical protein binding
          protein homodimerization activity
          metal chelating activity
          tau protein binding
          low-density lipoprotein particle receptor binding
          phosphatidylcholine-sterol O-acyltransferase activator activity
          very-low-density lipoprotein particle receptor binding
          lipoprotein particle binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-8jdkq:80/100.66.75.107:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0