Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Enterprise Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_100657057_10
          See other LOC105375056 GT Assays ›
          SNP ID:
          rs75932628
          Gene
          LOC105375056 TREM2 TREML1
          Gene Name
          uncharacterized LOC105375056
          triggering receptor expressed on myeloid cells 2
          triggering receptor expressed on myeloid cells like 1
          Set Membership:
          -
          Chromosome Location:
          Chr.6: 41161514 - 41161514 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TCCCAGCTGGCGGCACCAGGCCTTG[C/T]GCCTCCCCCAGTGCTTCATGGAGTC

          Assay ID C_100657057_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 605086 MIM: 609714

          Literature Links:

          LOC105375056 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.01)
          (0.99)
          AMR
          T (0.00)
          (1.00)
          LOC105375056 - uncharacterized LOC105375056
          There are no transcripts associated with this gene.
          TREM2 - triggering receptor expressed on myeloid cells 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001271821.1 244 Missense Mutation NP_001258750.1
          NM_018965.3 244 Missense Mutation NP_061838.1
          XM_006715116.3 244 Intron XP_006715179.1
          TREML1 - triggering receptor expressed on myeloid cells like 1
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          immunoglobulin receptor superfamily

          Gene Ontology Categories:

          Function(s) Process(es)

          positive regulation of antigen processing and presentation of peptide antigen via MHC class II
          phagocytosis, engulfment
          humoral immune response
          detection of lipopolysaccharide
          detection of peptidoglycan
          innate immune response
          positive regulation of peptidyl-tyrosine phosphorylation
          regulation of immune response
          positive regulation of calcium-mediated signaling
          positive regulation of ERK1 and ERK2 cascade
          detection of lipoteichoic acid
          cellular response to lipoteichoic acid
          cellular response to peptidoglycan
          dendritic cell differentiation
          positive regulation of protein localization to plasma membrane
          positive regulation of C-C chemokine receptor CCR7 signaling pathway
          positive regulation of CD40 signaling pathway
          lipopolysaccharide binding
          receptor activity
          peptidoglycan binding
          lipoteichoic acid binding
          scaffold protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2025 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-55658555d6-l4lw6:80/100.66.75.127:80.
          git-commit: ec8e7df5f8fec8d765bd419205f1b5046a016d37
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.41.0-Offline