Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_100661271_10
          See other CUL7 GT Assays ›
          SNP ID:
          rs77976555
          Gene
          CUL7 RRP36
          Gene Name
          cullin 7
          ribosomal RNA processing 36
          Set Membership:
          -
          Chromosome Location:
          Chr.6: 43037897 - 43037897 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TCATGGCGTCTCAGCGTGCCCTTGC[C/T]CAGGAGGTGTAGGATGCAGGAGAGG

          Assay ID C_100661271_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 609577 MIM: 613475

          Literature Links:

          CUL7 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.00)
          (1.00)
          AMR
          T (0.00)
          (1.00)
          CUL7 - cullin 7
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001168370.1 5264 Missense Mutation AGC,GGC S,G 1714 NP_001161842.1
          NM_014780.4 5264 Missense Mutation AGC,GGC S,G 1630 NP_055595.2
          XM_005249503.2 5264 Missense Mutation AGC,GGC S,G 1682 XP_005249560.1
          XM_006715285.1 5264 Missense Mutation AGC,GGC S,G 1666 XP_006715348.1
          XM_011515019.2 5264 Missense Mutation AGC,GGC S,G 1718 XP_011513321.1
          XM_011515020.2 5264 Missense Mutation AGC,GGC S,G 1686 XP_011513322.1
          XM_011515021.1 5264 Missense Mutation AGC,GGC S,G 921 XP_011513323.1
          XM_017011533.1 5264 Missense Mutation AGC,GGC S,G 1727 XP_016867022.1
          XM_017011534.1 5264 Missense Mutation AGC,GGC S,G 1723 XP_016867023.1
          XM_017011535.1 5264 Missense Mutation AGC,GGC S,G 1695 XP_016867024.1
          XM_017011536.1 5264 Missense Mutation AGC,GGC S,G 1675 XP_016867025.1
          XM_017011537.1 5264 Missense Mutation AGC,GGC S,G 1662 XP_016867026.1
          XM_017011538.1 5264 Missense Mutation AGC,GGC S,G 1643 XP_016867027.1
          XM_017011539.1 5264 Missense Mutation AGC,GGC S,G 1634 XP_016867028.1
          XM_017011540.1 5264 Intron XP_016867029.1
          RRP36 - ribosomal RNA processing 36
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          microtubule cytoskeleton organization
          mitotic cytokinesis
          vasculogenesis
          epithelial to mesenchymal transition
          placenta development
          proteolysis
          ubiquitin-dependent protein catabolic process
          Golgi organization
          regulation of mitotic nuclear division
          viral process
          protein ubiquitination
          IRE1-mediated unfolded protein response
          positive regulation of dendrite morphogenesis
          protein binding
          ubiquitin protein ligase binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-5cvsx:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline