Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_100685040_10
          See other GCLC GT Assays ›
          SNP ID:
          rs78850272
          Gene
          GCLC
          Gene Name
          glutamate-cysteine ligase catalytic subunit
          Set Membership:
          -
          Chromosome Location:
          Chr.6: 53502932 - 53502932 on Build GRCh38
          Polymorphism:
          A/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          AATAAATCCTGTTTCTATACTATTA[A/T]TAGTTTTCCTTAAAGAGGTAGTTTT

          Assay ID C_100685040_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 606857

          Literature Links:

          GCLC PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.08)
          (0.92)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.17)
          (0.83)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.01)
          (0.99)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.15)
          (0.85)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.02)
          (0.98)
          AMR
          T (0.03)
          (0.97)
          GCLC - glutamate-cysteine ligase catalytic subunit
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001197115.1 Intron NP_001184044.1
          NM_001498.3 Intron NP_001489.1
          XM_017010749.1 Intron XP_016866238.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          ligase

          Gene Ontology Categories:

          Function(s) Process(es)

          sulfur amino acid metabolic process
          cysteine metabolic process
          glutamate metabolic process
          glutathione biosynthetic process
          response to oxidative stress
          apoptotic mitochondrial changes
          response to heat
          response to xenobiotic stimulus
          response to hormone
          L-ascorbic acid metabolic process
          negative regulation of protein ubiquitination
          positive regulation of proteasomal ubiquitin-dependent protein catabolic process
          negative regulation of apoptotic process
          negative regulation of neuron apoptotic process
          cell redox homeostasis
          negative regulation of transcription, DNA-templated
          response to arsenic-containing substance
          regulation of blood vessel size
          response to nitrosative stress
          regulation of mitochondrial depolarization
          negative regulation of extrinsic apoptotic signaling pathway
          magnesium ion binding
          glutamate-cysteine ligase activity
          ATP binding
          glutamate binding
          ADP binding
          protein heterodimerization activity
          coenzyme binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-ctdjb:80/100.66.76.55:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0