Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTTGCCGTTTTGCCTCCTTTTCCA[A/G]TAACTCTGCCAGCAGCAAAGGATGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608259 MIM: 614624 | ||||||||||||||||||||
Literature Links: |
IGF2BP3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
IGF2BP3 - insulin like growth factor 2 mRNA binding protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006547.2 | 2087 | Intron | NP_006538.2 | |||
XM_006715639.2 | 2087 | Intron | XP_006715702.1 | |||
XM_011515089.2 | 2087 | Missense Mutation | ACT,ATT | T,I 508 | XP_011513391.1 | |
XM_011515090.2 | 2087 | Missense Mutation | ACT,ATT | T,I 395 | XP_011513392.1 | |
XM_011515091.2 | 2087 | Intron | XP_011513393.1 | |||
XM_011515092.2 | 2087 | Intron | XP_011513394.1 | |||
XM_011515093.2 | 2087 | Missense Mutation | ACT,ATT | T,I 410 | XP_011513395.1 |
MALSU1 - mitochondrial assembly of ribosomal large subunit 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |