Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_100933070_10
          See other PSMC2 GT Assays ›
          SNP ID:
          rs77840707
          Gene
          PSMC2 SLC26A5
          Gene Name
          proteasome 26S subunit, ATPase 2
          solute carrier family 26 member 5
          Set Membership:
          -
          Chromosome Location:
          Chr.7: 103356415 - 103356415 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          GGGGTCAAAGATATTATAGTTTTAA[A/G]ATCCTGTGAAAATTACTTTGGCCAG

          Assay ID C_100933070_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 154365 MIM: 604943

          Literature Links:

          PSMC2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.06)
          (0.94)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          G (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          G (0.01)
          (0.99)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          G (0.16)
          (0.84)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          G (0.05)
          (0.95)
          AMR
          G (0.03)
          (0.97)
          PSMC2 - proteasome 26S subunit, ATPase 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001204453.1 Intron NP_001191382.1
          NM_002803.3 Intron NP_002794.1
          XM_005250505.1 Intron XP_005250562.1
          SLC26A5 - solute carrier family 26 member 5
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001167962.1 Intron NP_001161434.1
          NM_001321787.1 Intron NP_001308716.1
          NM_198999.2 Intron NP_945350.1
          NM_206883.2 Intron NP_996766.1
          NM_206884.2 Intron NP_996767.1
          NM_206885.2 Intron NP_996768.1
          XM_011516170.2 Intron XP_011514472.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          protease transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          MAPK cascade
          protein polyubiquitination
          osteoblast differentiation
          stimulatory C-type lectin receptor signaling pathway
          antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent
          ubiquitin-dependent protein catabolic process
          regulation of cellular amino acid metabolic process
          viral process
          ER-associated ubiquitin-dependent protein catabolic process
          anaphase-promoting complex-dependent catabolic process
          tumor necrosis factor-mediated signaling pathway
          NIK/NF-kappaB signaling
          Fc-epsilon receptor signaling pathway
          proteasome-mediated ubiquitin-dependent protein catabolic process
          regulation of mRNA stability
          positive regulation of RNA polymerase II transcriptional preinitiation complex assembly
          T cell receptor signaling pathway
          negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle
          positive regulation of ubiquitin-protein ligase activity involved in regulation of mitotic cell cycle transition
          Wnt signaling pathway, planar cell polarity pathway
          negative regulation of canonical Wnt signaling pathway
          positive regulation of canonical Wnt signaling pathway
          positive regulation of proteasomal protein catabolic process
          response to ischemia
          sensory perception of sound
          regulation of cell shape
          response to salicylic acid
          response to auditory stimulus
          bicarbonate transport
          fructose transport
          oxalate transport
          negative regulation of ion transmembrane transport
          response to potassium ion
          regulation of membrane potential
          response to drug
          positive regulation of cell size
          protein tetramerization
          regulation of intracellular pH
          cochlea development
          response to thyroid hormone
          response to salt
          sulfate transmembrane transport
          chloride transmembrane transport
          positive regulation of cell motility
          protein binding
          ATP binding
          ATPase activity
          TBP-class protein binding
          proteasome-activating ATPase activity
          chloride channel activity
          transcription factor binding
          secondary active sulfate transmembrane transporter activity
          bicarbonate transmembrane transporter activity
          sulfate transmembrane transporter activity
          anion:anion antiporter activity
          oxalate transmembrane transporter activity
          spectrin binding
          protein homodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline