Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_100951168_10
          See other IMMP2L GT Assays ›
          SNP ID:
          rs77080369
          Gene
          IMMP2L LRRN3
          Gene Name
          inner mitochondrial membrane peptidase subunit 2
          leucine rich repeat neuronal 3
          Set Membership:
          -
          Chromosome Location:
          Chr.7: 111106595 - 111106595 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TTGCTATTTTGAGGTGGAGACTCAA[A/G]TAGGGCAAGAGTTGGTGAAGTATGG

          Assay ID C_100951168_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 605977

          Literature Links:

          IMMP2L PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          G (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          G (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          G (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          G (0.02)
          (0.98)
          AMR
          G (0.00)
          (1.00)
          IMMP2L - inner mitochondrial membrane peptidase subunit 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001244606.1 Intron NP_001231535.1
          NM_032549.3 Intron NP_115938.1
          XM_005250630.3 Intron XP_005250687.1
          XM_011516605.2 Intron XP_011514907.1
          XM_011516608.2 Intron XP_011514910.1
          XM_011516609.2 Intron XP_011514911.1
          XM_011516611.2 Intron XP_011514913.1
          XM_011516613.2 Intron XP_011514915.1
          XM_017012699.1 Intron XP_016868188.1
          XM_017012700.1 Intron XP_016868189.1
          XM_017012701.1 Intron XP_016868190.1
          XM_017012702.1 Intron XP_016868191.1
          XM_017012703.1 Intron XP_016868192.1
          XM_017012704.1 Intron XP_016868193.1
          XM_017012705.1 Intron XP_016868194.1
          LRRN3 - leucine rich repeat neuronal 3
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001099658.1 Intron NP_001093128.1
          NM_001099660.1 Intron NP_001093130.1
          NM_018334.4 Intron NP_060804.3

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          protease transmembrane signal receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          ovarian follicle development
          signal peptide processing
          protein processing involved in protein targeting to mitochondrion
          superoxide metabolic process
          cellular response to DNA damage stimulus
          spermatogenesis
          brain development
          blood circulation
          respiratory electron transport chain
          ovulation
          mitochondrial respiratory chain complex assembly
          cerebellum vasculature development
          serine-type endopeptidase activity
          peptidase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline