Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Pipettes and Pipette Tips
    • Lab Centrifuges
    • Ultra-Low Temperature Freezers
    • Spectroscopy
    • Beakers
    • PCR Equipment and Supplies
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • See all product categories
  • Applications
    • Cell Analysis
    • Lab Equipment
    • Real-Time PCR
    • PCR
    • Chromatography
    • Cell Culture and Transfection
    • DNA and RNA Extraction and Analysis
    • Protein Biology
    • Flow Cytometry
    • Chemicals
    • See all applications and techniques
  • Services
    • Custom Services
    • Lab Informatics
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Instrument Services
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • Customer Center
    • Contact Us
    • Certificates of Analysis and Conformance
    • Safety Data Sheets (SDS)
    • Manuals
    • How to Cite Our Products in a Paper
    • Instrument Support
    • Knowledge Base and Product FAQs
    • Learning Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_101715440_10
          See other ETV6 GT Assays ›
          SNP ID:
          rs80161692
          Gene
          ETV6
          Gene Name
          ETS variant 6
          Set Membership:
          -
          Chromosome Location:
          Chr.12: 11784646 - 11784646 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TTGGCAAGTGAGGAAGAGCGGAGTT[C/T]GGAAACAGGAGTGGGGCAAGAGGAC

          Assay ID C_101715440_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 600618

          Literature Links:

          ETV6 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.02)
          (0.98)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.06)
          (0.94)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.00)
          (1.00)
          AMR
          T (0.01)
          (0.99)
          ETV6 - ETS variant 6
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001987.4 Intron NP_001978.1
          XM_011520607.2 Intron XP_011518909.1
          XM_011520608.2 Intron XP_011518910.1
          XM_011520609.2 Intron XP_011518911.1
          XM_011520611.2 Intron XP_011518913.1
          XM_011520612.2 Intron XP_011518914.1
          XM_017018990.1 Intron XP_016874479.1
          XM_017018991.1 Intron XP_016874480.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          winged helix/forkhead transcription factor

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          transcription from RNA polymerase II promoter
          cell differentiation
          positive regulation of transcription from RNA polymerase II promoter
          hematopoietic stem cell proliferation
          RNA polymerase II regulatory region sequence-specific DNA binding
          RNA polymerase II core promoter proximal region sequence-specific DNA binding
          RNA polymerase II transcription factor activity, sequence-specific DNA binding
          transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding
          transcriptional repressor activity, RNA polymerase II transcription regulatory region sequence-specific binding
          transcription factor activity, sequence-specific DNA binding
          protein binding
          protein domain specific binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Fair Trade Fair Trade
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Korea flag icon
          Korea

          Customer Help Desk | working day 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          Service Call Center | working day 09:00~18:00
          1661-5055   |   Live Chat

          Customer Help Desk | working day 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          Service Call Center | working day 09:00~18:00
          1661-5055   |   Live Chat

          Customer Help Desk | working day 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          Service Call Center | working day 09:00~18:00
          1661-5055   |   Live Chat

          Thermo Fisher Scientific Korea Ltd.
          Representative : Soojin Seok
          Company Registration No. : 117-81-46910

           

          Thermo Fisher Scientific Solutions LLC
          Representative : Soojin Seok
          Company Registration No. : 114-86-04783

           

          Location: 12F Suseo Office Building, 281 Gwangpyeong-ro, Gangnam-gu, Seoul, Korea(06349) | Mail-Order Business Registration : 2015-Seoul Gangnam-00898 | Payment : ShinHan Bank 140-004-396660 (Thermo Fisher Scientific Solutions LLC)

          ISMS Logo

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline