Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_102259848_10
          See other CDK12 GT Assays ›
          SNP ID:
          rs79630893
          Gene
          CDK12
          Gene Name
          cyclin dependent kinase 12
          Set Membership:
          -
          Chromosome Location:
          Chr.17: 39462500 - 39462500 on Build GRCh38
          Polymorphism:
          G/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          AAGTCTCCAGCAAGTCGGGATCGAT[G/T]AAGGACCGGATATCGGGAAGTTCAA

          Assay ID C_102259848_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 615514

          Literature Links:

          CDK12 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          CDK12 - cyclin dependent kinase 12
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_015083.2 990 Missense Mutation ATG,ATT M,I 143 NP_055898.1
          NM_016507.3 990 Missense Mutation ATG,ATT M,I 143 NP_057591.2
          XM_005257456.3 990 Missense Mutation ATG,ATT M,I 143 XP_005257513.1
          XM_005257458.4 990 Missense Mutation ATG,ATT M,I 143 XP_005257515.1
          XM_011524892.2 990 Missense Mutation ATG,ATT M,I 143 XP_011523194.1
          XM_011524893.2 990 Missense Mutation ATG,ATT M,I 143 XP_011523195.1
          XM_011524894.2 990 Missense Mutation ATG,ATT M,I 143 XP_011523196.1
          XM_011524895.2 990 Missense Mutation ATG,ATT M,I 143 XP_011523197.1
          XM_011524896.2 990 Missense Mutation ATG,ATT M,I 143 XP_011523198.1
          XM_011524897.2 990 Missense Mutation ATG,ATT M,I 143 XP_011523199.1
          XM_011524898.2 990 Missense Mutation ATG,ATT M,I 143 XP_011523200.1
          XM_011524899.2 990 Missense Mutation ATG,ATT M,I 143 XP_011523201.1
          XM_011524900.2 990 Missense Mutation ATG,ATT M,I 143 XP_011523202.1
          XM_011524901.2 990 Missense Mutation ATG,ATT M,I 143 XP_011523203.1
          XM_011524902.2 990 Missense Mutation ATG,ATT M,I 143 XP_011523204.1
          XM_011524903.2 990 Missense Mutation ATG,ATT M,I 143 XP_011523205.1
          XM_011524905.2 990 Missense Mutation ATG,ATT M,I 143 XP_011523207.1
          XM_011524906.2 990 Missense Mutation ATG,ATT M,I 143 XP_011523208.1
          XM_011524907.2 990 Missense Mutation ATG,ATT M,I 143 XP_011523209.1
          XM_017024744.1 990 Missense Mutation ATG,ATT M,I 143 XP_016880233.1
          XM_017024745.1 990 Missense Mutation ATG,ATT M,I 143 XP_016880234.1
          XM_017024746.1 990 Missense Mutation ATG,ATT M,I 143 XP_016880235.1
          XM_017024747.1 990 Missense Mutation ATG,ATT M,I 143 XP_016880236.1
          XM_017024748.1 990 Missense Mutation ATG,ATT M,I 143 XP_016880237.1
          XM_017024749.1 990 Missense Mutation ATG,ATT M,I 143 XP_016880238.1
          XM_017024750.1 990 Missense Mutation ATG,ATT M,I 143 XP_016880239.1
          XM_017024751.1 990 Missense Mutation ATG,ATT M,I 143 XP_016880240.1
          XM_017024752.1 990 Missense Mutation ATG,ATT M,I 143 XP_016880241.1
          XM_017024753.1 990 Missense Mutation ATG,ATT M,I 143 XP_016880242.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          non-receptor serine/threonine protein kinase

          Gene Ontology Categories:

          Function(s) Process(es)

          mRNA processing
          RNA splicing
          regulation of MAP kinase activity
          regulation of RNA splicing
          protein autophosphorylation
          regulation of cell cycle
          phosphorylation of RNA polymerase II C-terminal domain
          protein kinase activity
          cyclin-dependent protein serine/threonine kinase activity
          protein binding
          ATP binding
          RNA polymerase II carboxy-terminal domain kinase activity
          cyclin binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-b2k9d:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline