Search Thermo Fisher Scientific
- Order Status
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
CTACCAGCGGGTACTGCCGCTGCCC[C/A]TCTTCACCCCTGCCAAGATGGGCGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611801 MIM: 171190 MIM: 607048 MIM: 604488 | ||||||||||||||||||||
Literature Links: |
PGAP3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PGAP3 - post-GPI attachment to proteins 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PNMT - phenylethanolamine N-methyltransferase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STARD3 - StAR related lipid transfer domain containing 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TCAP - titin-cap | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003673.3 | 291 | Missense Mutation | ATC,CTC | I,L 93 | NP_003664.1 |