Hamburger Menu Button
Thermo Fisher Scientific Logo
Faça o login
Não tem uma conta? Criar Conta​
  • Produtos
    • Consumíveis de Laboratório
    • Equipamentos de Laboratório
    • Instrumentos de Laboratório
    • Clínica & Diagnóstico
    • Cromatografia
    • Espectrômetria de Massas
    • Cultura Celular
    • Análise Celular
    • Anticorpos
    • Biologia Molecular & Análise de Ácidos Nucleicos
    • Produtos Ácidos Nucleicos Específicos de Sequência
    • Veja todas as categorias de produtos
  • Aplicações
    • Cultura Celular e Transfecção
    • Citometria de Fluxo
    • Pesquisa em Oncologia
    • Cromatografia
    • Sequenciamento
    • PCR
    • Soluções Laboratoriais
    • Diagnóstico de Alergias
    • Veja todas as aplicações e técnicas
  • Serviços
    • Serviços de Instrumentos e Equipamentos de Laboratório
    • Serviços Personalizados
    • Serviços de Treinamento
    • Informática de Laboratório em Nível Empresarial
    • Serviços Financeiros e de Arrendamento
    • CDMO & Serviços de Ensaios Clínicos
    • Veja todas as serviços
  • Ajuda e suporte
    • Cadastre-se em nosso site
    • Como fazer o pedido
    • Entre em Contato Conosco
    • Mudança de Localização do Site
    • Veja todos os tópicos de ajuda e suporte
  • Popular
    • Our Instagram
      Nosso Instagram
    • Our Facebook
      Nosso Facebook
    • Blog Behind the Bench
      Blog Behind the Bench
    • Customer Experience Center (CEC)
      Customer Experience Center (CEC)
    • Ecommerce Exclusives
  • Quem atendemos
    • Setor de Biotecnologia
    • Indústria Biofarmacêutica
    • CDMO
    • Diagnósticos Laboratoriais
    • Ciência Industrial e Aplicada
  • Ofertas especiais
  • Fale Conosco
  • Pedido rápido
  • Documentos e certificados
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Fale Conosco
          • Pedido rápido
          • Faça o login
            Faça o login
            Não tem uma conta? Criar Conta​
            • Conta
            • Status do pedido
            • Produtos Customizados & Projetos
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_102325236_10
          See other C17ORF50 GT Assays ›
          SNP ID:
          rs79277945
          Gene
          C17orf50 GAS2L2 MMP28
          Gene Name
          chromosome 17 open reading frame 50
          growth arrest specific 2 like 2
          matrix metallopeptidase 28
          Set Membership:
          -
          Chromosome Location:
          Chr.17: 35762483 - 35762483 on Build GRCh38
          Polymorphism:
          A/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          AGCTTAGTTTCCATGTCAGCCCAGG[A/T]ACTTTCTGCTGGGGCTACTGCTTGT

          Assay ID C_102325236_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 611398 MIM: 608417

          Literature Links:

          C17orf50 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.08)
          (0.92)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.01)
          (0.99)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.22)
          (0.78)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.09)
          (0.91)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.05)
          (0.95)
          AMR
          T (0.03)
          (0.97)
          C17orf50 - chromosome 17 open reading frame 50
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_145272.3 Intron NP_660315.2
          GAS2L2 - growth arrest specific 2 like 2
          There are no transcripts associated with this gene.
          MMP28 - matrix metallopeptidase 28
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001032278.2 Intron NP_001027449.1
          NM_024302.4 Intron NP_077278.1
          NM_032950.3 Intron NP_116568.1
          XM_011525225.1 Intron XP_011523527.1
          XM_011525226.2 Intron XP_011523528.1
          XM_011525227.1 Intron XP_011523529.1
          XM_011525228.1 Intron XP_011523530.1
          XM_011525229.2 Intron XP_011523531.1
          XM_011525230.1 Intron XP_011523532.1
          XM_011525231.1 Intron XP_011523533.1
          XM_011525232.2 Intron XP_011523534.2
          XM_017025061.1 Intron XP_016880550.1
          XM_017025062.1 Intron XP_016880551.1
          XM_017025063.1 Intron XP_016880552.1
          XM_017025064.1 Intron XP_016880553.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          metalloprotease

          Gene Ontology Categories:

          Function(s) Process(es)

          proteolysis
          negative regulation of macrophage chemotaxis
          metalloendopeptidase activity
          calcium ion binding
          zinc ion binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Status do pedido
          • Ajuda para pedidos
          • Pedido rápido
          • Supply Center
          • eProcurement
          Suporte Plus Icon Minus Icon
          • Ajuda e suporte
          • Entre em Contato
          • Centros de Suporte Técnico
          • Obter Documentos e Certificados
          • Informe um Problema no Site
          Recursos Plus Icon Minus Icon
          • Centros de aprendizagem
          • Promoções
          • Eventos & Webinars
          • Mídia Sociais
          Sobre a Thermo Fisher Plus Icon Minus Icon
          • Sobre Nós Sobre Nós
          • Carreiras Carreiras
          • Investidores Investidores
          • Sala de Impresa Sala de Impresa
          • Responsabilidade Social Responsabilidade Social
          • Marcas
          • Políticas e avisos
          Nosso Portfólio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Brasil flag icon
          Brasil

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-9kpsn:80/100.66.79.221:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0