Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
GTAAGACCTTCCTGGGACCGCAGCC[A/G]CTCAGTCCTCGTTCTTCTCATGCAT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600944 MIM: 609458 MIM: 616850 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DHPS PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DHPS - deoxyhypusine synthase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001206974.1 | 1244 | UTR 3 | NP_001193903.1 | |||
NM_001930.3 | 1244 | UTR 3 | NP_001921.1 | |||
NM_013406.2 | 1244 | UTR 3 | NP_037538.1 | |||
XM_011527770.1 | 1244 | UTR 3 | XP_011526072.1 | |||
XM_011527771.2 | 1244 | UTR 3 | XP_011526073.1 |
MAN2B1 - mannosidase alpha class 2B member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WDR83 - WD repeat domain 83 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001099737.2 | 1244 | Intron | NP_001093207.1 | |||
NM_032332.3 | 1244 | Intron | NP_115708.1 |
WDR83OS - WD repeat domain 83 opposite strand | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |