Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_102967287_10
          See other BDH2 GT Assays ›
          SNP ID:
          rs78520312
          Gene
          BDH2 SLC9B2
          Gene Name
          3-hydroxybutyrate dehydrogenase, type 2
          solute carrier family 9 member B2
          Set Membership:
          -
          Chromosome Location:
          Chr.4: 103077703 - 103077703 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          ACCTGCTCACAGCATAAAGTATTTC[A/G]TGACATACTTGTAAGAGTCAGTGTT

          Assay ID C_102967287_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 611789

          Literature Links:

          BDH2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          G (0.01)
          (0.99)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          G (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          G (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          G (0.00)
          (1.00)
          AMR
          G (0.00)
          (1.00)
          BDH2 - 3-hydroxybutyrate dehydrogenase, type 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_020139.3 Intron NP_064524.3
          XM_005263140.3 Intron XP_005263197.1
          XM_006714274.3 Intron XP_006714337.1
          XM_011532127.2 Intron XP_011530429.1
          XM_011532128.2 Intron XP_011530430.1
          XM_017008461.1 Intron XP_016863950.1
          XM_017008462.1 Intron XP_016863951.1
          SLC9B2 - solute carrier family 9 member B2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001300754.1 Intron NP_001287683.1
          NM_001300756.1 Intron NP_001287685.1
          NM_178833.5 Intron NP_849155.2
          XM_006714085.2 Intron XP_006714148.1
          XM_006714086.3 Intron XP_006714149.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          dehydrogenase

          Gene Ontology Categories:

          Function(s) Process(es)

          fatty acid beta-oxidation
          siderophore biosynthetic process
          epithelial cell differentiation
          heme metabolic process
          ketone body biosynthetic process
          iron ion homeostasis
          sodium ion transport
          ion transmembrane transport
          hydrogen ion transmembrane transport
          positive regulation of osteoclast development
          3-hydroxybutyrate dehydrogenase activity
          oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor
          NAD binding
          monovalent cation:proton antiporter activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Spain flag icon
          Spain

          TEST

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-pgj68:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline