Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Western Blot Products
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Food and Beverage
    • Lab Solutions
    • Pharma and Biopharma
    • Real-Time PCR
    • Semiconductor Analysis
    • Clinical and Diagnostics
    • Digital Solutions
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • See all services
  • Help and Support
    • Order Help
    • Digital Solutions
    • Product Support
    • Technical Information
    • Training and Education
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_104360166_10
          See other FAT2 GT Assays ›
          SNP ID:
          rs77216756
          Gene
          FAT2 SLC36A1
          Gene Name
          FAT atypical cadherin 2
          solute carrier family 36 member 1
          Set Membership:
          -
          Chromosome Location:
          Chr.5: 151504354 - 151504354 on Build GRCh38
          Polymorphism:
          G/T, Transversion Substitution
          Context Sequence [VIC/FAM]:

          GACTGGGTGGGAGGGAGTGGTGAGG[G/T]CACCAAAGGCCACAGAGGCTTCTGG

          Assay ID C_104360166_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 604269 MIM: 606561

          Literature Links:

          FAT2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.04)
          (0.96)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          G (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          G (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          G (0.15)
          (0.85)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          G (0.00)
          (1.00)
          AMR
          G (0.01)
          (0.99)
          FAT2 - FAT atypical cadherin 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001447.2 14615 UTR 3 NP_001438.1
          XM_006714761.3 14615 UTR 3 XP_006714824.1
          XM_011537600.2 14615 UTR 3 XP_011535902.1
          XM_011537603.2 14615 UTR 3 XP_011535905.1
          XM_017009224.1 14615 UTR 3 XP_016864713.1
          XM_017009225.1 14615 UTR 3 XP_016864714.1
          XM_017009226.1 14615 Intron XP_016864715.1
          XM_017009227.1 14615 Intron XP_016864716.1
          SLC36A1 - solute carrier family 36 member 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001308150.1 14615 Intron NP_001295079.1
          NM_001308151.1 14615 Intron NP_001295080.1
          NM_078483.3 14615 Intron NP_510968.2
          XM_005268386.1 14615 Intron XP_005268443.1
          XM_006714759.3 14615 Intron XP_006714822.1
          XM_011537580.2 14615 Intron XP_011535882.1
          XM_011537581.1 14615 Intron XP_011535883.1
          XM_011537583.2 14615 Intron XP_011535885.1
          XM_011537584.2 14615 Intron XP_011535886.1
          XM_011537585.1 14615 Intron XP_011535887.1
          XM_011537586.2 14615 Intron XP_011535888.1
          XM_011537587.2 14615 Intron XP_011535889.1
          XM_011537588.2 14615 Intron XP_011535890.1
          XM_011537589.2 14615 Intron XP_011535891.1
          XM_011537590.1 14615 Intron XP_011535892.1
          XM_011537591.1 14615 Intron XP_011535893.1
          XM_011537592.2 14615 Intron XP_011535894.1
          XM_011537593.2 14615 Intron XP_011535895.1
          XM_011537594.1 14615 Intron XP_011535896.1
          XM_011537595.2 14615 Intron XP_011535897.2
          XM_011537596.2 14615 Intron XP_011535898.2
          XM_017009216.1 14615 Intron XP_016864705.1
          XM_017009217.1 14615 Intron XP_016864706.1
          XM_017009218.1 14615 Intron XP_016864707.1
          XM_017009219.1 14615 Intron XP_016864708.1
          XM_017009220.1 14615 Intron XP_016864709.1

          Back To Top

          More Information


          Additional Information:

          For this assay, SNP(s) [rs141393219] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

          Panther Classification:

          Molecular Function -

          amino acid transporter transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          homophilic cell adhesion via plasma membrane adhesion molecules
          epithelial cell migration
          ion transport
          amino acid transport
          L-alanine transport
          glycine transport
          proline transport
          proline transmembrane transport
          hydrogen ion transmembrane transport
          calcium ion binding
          hydrogen:amino acid symporter activity
          hydrogen ion transmembrane transporter activity
          amino acid transmembrane transporter activity
          L-alanine transmembrane transporter activity
          glycine transmembrane transporter activity
          L-proline transmembrane transporter activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Taiwan flag icon
          Taiwan

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-d59m7:80/100.66.79.221:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0