Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_104550988_10
          See other DLG1 GT Assays ›
          SNP ID:
          rs75101044
          Gene
          DLG1
          Gene Name
          discs large MAGUK scaffold protein 1
          Set Membership:
          -
          Chromosome Location:
          Chr.3: 197044721 - 197044721 on Build GRCh38
          Polymorphism:
          T/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          TAAATGTCTTCCAGCGTATCCCCCT[T/G]TACAATAGCTGTAATGATAGAAACA

          Assay ID C_104550988_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 601014

          Literature Links:

          DLG1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          DLG1 - discs large MAGUK scaffold protein 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001098424.1 2760 Missense Mutation AAG,CAG K,Q 873 NP_001091894.1
          NM_001204386.1 2760 Missense Mutation AAG,CAG K,Q 861 NP_001191315.1
          NM_001204387.1 2760 Missense Mutation AAG,CAG K,Q 769 NP_001191316.1
          NM_001204388.1 2760 Missense Mutation AAG,CAG K,Q 757 NP_001191317.1
          NM_001290983.1 2760 Missense Mutation AAG,CAG K,Q 873 NP_001277912.1
          NM_004087.2 2760 Missense Mutation AAG,CAG K,Q 895 NP_004078.2
          XM_005269289.3 2760 Missense Mutation AAG,CAG K,Q 895 XP_005269346.1
          XM_011512502.2 2760 Missense Mutation AAG,CAG K,Q 873 XP_011510804.1
          XM_011512503.1 2760 Missense Mutation AAG,CAG K,Q 861 XP_011510805.1
          XM_011512505.1 2760 Missense Mutation AAG,CAG K,Q 840 XP_011510807.1
          XM_011512506.1 2760 Missense Mutation AAG,CAG K,Q 822 XP_011510808.1
          XM_011512509.1 2760 Intron XP_011510811.1
          XM_017005800.1 2760 Missense Mutation AAG,CAG K,Q 895 XP_016861289.1
          XM_017005801.1 2760 Missense Mutation AAG,CAG K,Q 895 XP_016861290.1
          XM_017005802.1 2760 Missense Mutation AAG,CAG K,Q 895 XP_016861291.1
          XM_017005803.1 2760 Missense Mutation AAG,CAG K,Q 895 XP_016861292.1
          XM_017005804.1 2760 Missense Mutation AAG,CAG K,Q 894 XP_016861293.1
          XM_017005805.1 2760 Missense Mutation AAG,CAG K,Q 873 XP_016861294.1
          XM_017005806.1 2760 Missense Mutation AAG,CAG K,Q 862 XP_016861295.1
          XM_017005807.1 2760 Missense Mutation AAG,CAG K,Q 862 XP_016861296.1
          XM_017005808.1 2760 Missense Mutation AAG,CAG K,Q 862 XP_016861297.1
          XM_017005809.1 2760 Missense Mutation AAG,CAG K,Q 862 XP_016861298.1
          XM_017005810.1 2760 Missense Mutation AAG,CAG K,Q 861 XP_016861299.1
          XM_017005811.1 2760 Missense Mutation AAG,CAG K,Q 844 XP_016861300.1
          XM_017005812.1 2760 Missense Mutation AAG,CAG K,Q 844 XP_016861301.1
          XM_017005813.1 2760 Missense Mutation AAG,CAG K,Q 844 XP_016861302.1
          XM_017005814.1 2760 Missense Mutation AAG,CAG K,Q 844 XP_016861303.1
          XM_017005815.1 2760 Missense Mutation AAG,CAG K,Q 843 XP_016861304.1
          XM_017005816.1 2760 Missense Mutation AAG,CAG K,Q 840 XP_016861305.1
          XM_017005817.1 2760 Missense Mutation AAG,CAG K,Q 840 XP_016861306.1
          XM_017005818.1 2760 Missense Mutation AAG,CAG K,Q 840 XP_016861307.1
          XM_017005819.1 2760 Missense Mutation AAG,CAG K,Q 840 XP_016861308.1
          XM_017005820.1 2760 Missense Mutation AAG,CAG K,Q 822 XP_016861309.1
          XM_017005821.1 2760 Missense Mutation AAG,CAG K,Q 812 XP_016861310.1
          XM_017005822.1 2760 Missense Mutation AAG,CAG K,Q 790 XP_016861311.1
          XM_017005823.1 2760 Missense Mutation AAG,CAG K,Q 779 XP_016861312.1
          XM_017005824.1 2760 Missense Mutation AAG,CAG K,Q 488 XP_016861313.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          scaffold/adaptor protein

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          branching involved in ureteric bud morphogenesis
          immunological synapse formation
          endothelial cell proliferation
          lens development in camera-type eye
          T cell cytokine production
          protein dephosphorylation
          actin filament organization
          mitotic cell cycle checkpoint
          establishment or maintenance of cell polarity
          chemical synaptic transmission
          nervous system development
          positive regulation of cell proliferation
          regulation of cell shape
          viral process
          single organismal cell-cell adhesion
          peristalsis
          positive regulation of actin filament polymerization
          cortical actin cytoskeleton organization
          astral microtubule organization
          membrane raft organization
          regulation of myelination
          activation of protein kinase activity
          ion transmembrane transport
          cellular protein complex localization
          T cell activation
          negative regulation of T cell proliferation
          regulation of membrane potential
          amyloid precursor protein metabolic process
          receptor clustering
          positive regulation of potassium ion transport
          cortical microtubule organization
          establishment or maintenance of epithelial cell apical/basal polarity
          negative regulation of mitotic cell cycle
          GMP metabolic process
          GDP metabolic process
          reproductive structure development
          embryonic skeletal system morphogenesis
          smooth muscle tissue development
          negative regulation of epithelial cell proliferation
          establishment of centrosome localization
          negative regulation of protein kinase B signaling
          hard palate development
          negative regulation of ERK1 and ERK2 cascade
          bicellular tight junction assembly
          protein localization to plasma membrane
          positive regulation of establishment of protein localization to plasma membrane
          receptor localization to synapse
          regulation of NIK/NF-kappaB signaling
          regulation of sodium ion transmembrane transport
          negative regulation of p38MAPK cascade
          guanylate kinase activity
          phosphoprotein phosphatase activity
          protein binding
          protein C-terminus binding
          cytoskeletal protein binding
          ligand-gated ion channel activity
          potassium channel regulator activity
          protein kinase binding
          phosphatase binding
          mitogen-activated protein kinase kinase binding
          protein complex scaffold
          ionotropic glutamate receptor binding
          ion channel binding
          L27 domain binding
          cadherin binding involved in cell-cell adhesion

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-fbg7s:80/100.66.79.246:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline