Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_104935770_10
          See other LOC105369535 GT Assays ›
          SNP ID:
          rs74685827
          Gene
          LOC105369535 SORL1
          Gene Name
          uncharacterized LOC105369535
          sortilin related receptor 1
          Set Membership:
          -
          Chromosome Location:
          Chr.11: 121482368 - 121482368 on Build GRCh38
          Polymorphism:
          G/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          CTTAGATTCTCATGGGTGGATATTC[G/T]TTGGAGTTGGTGGGGTTGGAGAAGT

          Assay ID C_104935770_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602005

          Literature Links:

          LOC105369535 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.03)
          (0.97)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          G (0.10)
          (0.90)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          G (0.03)
          (0.97)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          G (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          G (0.02)
          (0.98)
          AMR
          G (0.01)
          (0.99)
          LOC105369535 - uncharacterized LOC105369535
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          XM_017018646.1 2439 UTR 5 XP_016874135.1
          XM_017018647.1 2439 UTR 5 XP_016874136.1
          XM_017018648.1 2439 UTR 5 XP_016874137.1
          XM_017018649.1 2439 UTR 5 XP_016874138.1
          XM_017018650.1 2439 UTR 5 XP_016874139.1
          XM_017018651.1 2439 UTR 5 XP_016874140.1
          SORL1 - sortilin related receptor 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_003105.5 2439 Intron NP_003096.1
          XM_011542963.2 2439 Intron XP_011541265.1
          XM_011542965.2 2439 Intron XP_011541267.1
          XM_011542967.2 2439 Intron XP_011541269.1
          XM_017018169.1 2439 Intron XP_016873658.1
          XM_017018170.1 2439 Intron XP_016873659.1
          XM_017018171.1 2439 Intron XP_016873660.1
          XM_017018172.1 2439 Intron XP_016873661.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          chaperone apolipoprotein membrane traffic protein

          Gene Ontology Categories:

          Function(s) Process(es)

          protein targeting to Golgi
          protein targeting
          protein targeting to lysosome
          lipid transport
          post-Golgi vesicle-mediated transport
          receptor-mediated endocytosis
          signal transduction
          cholesterol metabolic process
          regulation of smooth muscle cell migration
          negative regulation of protein binding
          negative regulation of protein oligomerization
          negative regulation of MAP kinase activity
          protein retention in Golgi apparatus
          positive regulation of protein catabolic process
          negative regulation of neurogenesis
          protein maturation
          positive regulation of protein exit from endoplasmic reticulum
          negative regulation of neuron death
          negative regulation of beta-amyloid formation
          positive regulation of choline O-acetyltransferase activity
          negative regulation of tau-protein kinase activity
          positive regulation of ER to Golgi vesicle-mediated transport
          positive regulation of early endosome to recycling endosome transport
          negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process
          negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process
          positive regulation of protein localization to early endosome
          negative regulation of neurofibrillary tangle assembly
          positive regulation of endocytic recycling
          beta-amyloid binding
          transmembrane signaling receptor activity
          protein binding
          low-density lipoprotein particle binding
          ADP-ribosylation factor binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-fkn7b:80/100.66.79.246:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline