Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Pipettes and Pipette Tips
    • Lab Centrifuges
    • Ultra-Low Temperature Freezers
    • Spectroscopy
    • Beakers
    • PCR Equipment and Supplies
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • See all product categories
  • Applications
    • Cell Analysis
    • Lab Equipment
    • Real-Time PCR
    • PCR
    • Chromatography
    • Cell Culture and Transfection
    • DNA and RNA Extraction and Analysis
    • Protein Biology
    • Flow Cytometry
    • Chemicals
    • See all applications and techniques
  • Services
    • Custom Services
    • Lab Informatics
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Instrument Services
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • Customer Center
    • Contact Us
    • Certificates of Analysis and Conformance
    • Safety Data Sheets (SDS)
    • Manuals
    • How to Cite Our Products in a Paper
    • Instrument Support
    • Knowledge Base and Product FAQs
    • Learning Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_105290254_10
          See other CNST GT Assays ›
          SNP ID:
          rs78486834
          Gene
          CNST
          Gene Name
          consortin, connexin sorting protein
          Set Membership:
          -
          Chromosome Location:
          Chr.1: 246658204 - 246658204 on Build GRCh38
          Polymorphism:
          T/C, Transition substitution
          Context Sequence [VIC/FAM]:

          AATATCAATGATACATCTTTAGTAG[T/C]AATGTATTCATGAAAATTAATTCTT

          Assay ID C_105290254_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          10 submissions

          Phenotype:

          MIM: 613439

          Literature Links:

          CNST PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.03)
          (0.97)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          C (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          C (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          C (0.09)
          (0.91)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          C (0.00)
          (1.00)
          AMR
          C (0.01)
          (0.99)
          CNST - consortin, connexin sorting protein
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001139459.1 Intron NP_001132931.1
          NM_152609.2 Intron NP_689822.2
          XM_005273081.3 Intron XP_005273138.2
          XM_005273083.4 Intron XP_005273140.1
          XM_011544110.2 Intron XP_011542412.1
          XM_011544111.1 Intron XP_011542413.1
          XM_011544112.1 Intron XP_011542414.1
          XM_011544113.1 Intron XP_011542415.1
          XM_011544114.2 Intron XP_011542416.1
          XM_017000487.1 Intron XP_016855976.1
          XM_017000488.1 Intron XP_016855977.1
          XM_017000489.1 Intron XP_016855978.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of phosphatase activity
          positive regulation of Golgi to plasma membrane protein transport
          protein binding
          phosphatase binding
          connexin binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Fair Trade Fair Trade
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Korea flag icon
          Korea

          Customer Help Desk | working day 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          Service Call Center | working day 09:00~18:00
          1661-5055   |   Live Chat

          Customer Help Desk | working day 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          Service Call Center | working day 09:00~18:00
          1661-5055   |   Live Chat

          Customer Help Desk | working day 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          Service Call Center | working day 09:00~18:00
          1661-5055   |   Live Chat

          Thermo Fisher Scientific Korea Ltd.
          Representative : Soojin Seok
          Company Registration No. : 117-81-46910

           

          Thermo Fisher Scientific Solutions LLC
          Representative : Soojin Seok
          Company Registration No. : 114-86-04783

           

          Location: 12F Suseo Office Building, 281 Gwangpyeong-ro, Gangnam-gu, Seoul, Korea(06349) | Mail-Order Business Registration : 2015-Seoul Gangnam-00898 | Payment : ShinHan Bank 140-004-396660 (Thermo Fisher Scientific Solutions LLC)

          ISMS Logo

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-5cvsx:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline