Hamburger Menu Button
Thermo Fisher Scientific Logo
로그인
회원이 아니신가요? 계정 생성하기
  • 모든 제품 주문
    • 항체
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR 분석
    • 피펫 및 피펫 팁
    • 실험실용 원심분리기
    • 초저온 냉동고
    • 분광학
    • 비이커
    • PCR 장비 및 용품
    • 제품 카테고리 전체보기
  • 응용 분야 및 기법
    • 세포 분석
    • 실험실 장비
    • Real-Time PCR
    • PCR
    • 크로마토그래피
    • 세포 배양 및 트랜스펙션
    • DNA/RNA 추출과 분석
    • 단백질 생물학
    • 유세포분석
    • 화학 제품
    • 응용 분야 및 기법 전체보기
  • 서비스
    • 맞춤형 서비스
    • 엔터프라이즈급 실험실 정보 처리
    • 360° CDMO 및 CRO 서비스
    • CDMO 서비스
    • 임상시험 CRO 서비스
    • 장비 서비스
    • 교육 서비스
    • Unity Lab Services
    • 서비스 전체 보기
  • 지원
    • 고객센터
    • 문의하기
    • 시험성적서(COA) 및 적합성 인증서(COC)
    • Safety Data Sheets (SDS)
    • 매뉴얼
    • 인용 및 참고 문헌
    • 기기 지원
    • 기술 자료/제품 FAQ
    • 학습 센터
    • 지원 메뉴 전체보기
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • 문의하기
  • 빠른 주문
  • 주문 현황
  • 제품 문서 검색
Thermo Fisher Scientific Logo

Search

전체검색
Search button
          • 주문 현황
          • 빠른주문
          • 로그인
            로그인
            회원이 아니신가요? 계정 생성하기
            • 계정정보
            • 주문내역조회
            • 커스텀제품 및 프로젝트
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_105348138_10
          See other FGFR1 GT Assays ›
          SNP ID:
          rs79300736
          Gene
          FGFR1
          Gene Name
          fibroblast growth factor receptor 1
          Set Membership:
          -
          Chromosome Location:
          Chr.8: 38450869 - 38450869 on Build GRCh38
          Polymorphism:
          T/C, Transition substitution
          Context Sequence [VIC/FAM]:

          CGGAGCCAAGAACACAGCCTCGGAG[T/C]GGCTTTGCTGCGCTTGCCCCAGCTT

          Assay ID C_105348138_10
          Size
          재고 정보 주문접수 후 제작
          Catalog # 4351379
          제품 정가
          Your Price
          온라인 행사가:
          공급가 확인 ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay 상세 정보



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 136350

          Literature Links:

          FGFR1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.01)
          (0.99)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          C (0.05)
          (0.95)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          C (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          C (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          C (0.00)
          (1.00)
          AMR
          C (0.00)
          (1.00)
          FGFR1 - fibroblast growth factor receptor 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001174063.1 413 Intron NP_001167534.1
          NM_001174064.1 413 Intron NP_001167535.1
          NM_001174065.1 413 Intron NP_001167536.1
          NM_001174066.1 413 Intron NP_001167537.1
          NM_001174067.1 413 Intron NP_001167538.1
          NM_015850.3 413 Intron NP_056934.2
          NM_023105.2 413 Intron NP_075593.1
          NM_023106.2 413 Intron NP_075594.1
          NM_023110.2 413 Intron NP_075598.2
          XM_006716303.2 413 Intron XP_006716366.1
          XM_006716304.1 413 Intron XP_006716367.1
          XM_006716306.2 413 Intron XP_006716369.1
          XM_006716307.1 413 Intron XP_006716370.1
          XM_006716309.3 413 UTR 5 XP_006716372.1
          XM_006716310.2 413 Intron XP_006716373.1
          XM_006716311.1 413 Intron XP_006716374.1
          XM_006716312.1 413 Intron XP_006716375.1
          XM_006716313.2 413 Intron XP_006716376.1
          XM_006716314.1 413 Intron XP_006716377.1
          XM_011544443.2 413 Intron XP_011542745.1
          XM_011544444.1 413 Intron XP_011542746.1
          XM_011544445.2 413 Intron XP_011542747.1
          XM_011544446.2 413 Intron XP_011542748.1
          XM_011544447.2 413 Intron XP_011542749.1
          XM_011544448.1 413 Intron XP_011542750.1
          XM_011544449.1 413 Intron XP_011542751.1
          XM_011544450.2 413 Intron XP_011542752.1
          XM_011544451.1 413 Intron XP_011542753.1
          XM_011544452.2 413 Intron XP_011542754.1
          XM_017013219.1 413 Intron XP_016868708.1
          XM_017013220.1 413 Intron XP_016868709.1
          XM_017013221.1 413 Intron XP_016868710.1
          XM_017013222.1 413 Intron XP_016868711.1
          XM_017013223.1 413 Intron XP_016868712.1
          XM_017013224.1 413 Intron XP_016868713.1
          XM_017013225.1 413 Intron XP_016868714.1
          XM_017013226.1 413 Intron XP_016868715.1
          XM_017013227.1 413 Intron XP_016868716.1
          XM_017013228.1 413 Intron XP_016868717.1
          XM_017013229.1 413 Intron XP_016868718.1
          XM_017013230.1 413 Intron XP_016868719.1
          XM_017013231.1 413 Intron XP_016868720.1

          Back To Top

          추가 정보


          Panther Classification:

          Molecular Function -

          transmembrane signal receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          MAPK cascade
          skeletal system development
          angiogenesis
          ureteric bud development
          in utero embryonic development
          organ induction
          neuron migration
          positive regulation of mesenchymal cell proliferation
          chondrocyte differentiation
          transcription, DNA-templated
          protein phosphorylation
          sensory perception of sound
          positive regulation of cell proliferation
          fibroblast growth factor receptor signaling pathway
          positive regulation of phospholipase activity
          positive regulation of phospholipase C activity
          positive regulation of neuron projection development
          regulation of phosphatidylinositol 3-kinase signaling
          positive regulation of phosphatidylinositol 3-kinase signaling
          cell migration
          peptidyl-tyrosine phosphorylation
          stem cell population maintenance
          motogenic signaling involved in postnatal olfactory bulb interneuron migration
          ventricular zone neuroblast division
          embryonic limb morphogenesis
          midbrain development
          neuron projection development
          fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development
          phosphatidylinositol-3-phosphate biosynthetic process
          inner ear morphogenesis
          outer ear morphogenesis
          middle ear morphogenesis
          chordate embryonic development
          positive regulation of MAP kinase activity
          positive regulation of MAPK cascade
          positive regulation of GTPase activity
          regulation of cell differentiation
          positive regulation of neuron differentiation
          negative regulation of osteoblast differentiation
          positive regulation of cell cycle
          protein autophosphorylation
          phosphatidylinositol phosphorylation
          phosphatidylinositol-mediated signaling
          paraxial mesoderm development
          regulation of lateral mesodermal cell fate specification
          cell maturation
          skeletal system morphogenesis
          mesenchymal cell differentiation
          regulation of sensory perception of pain
          positive regulation of cardiac muscle cell proliferation
          auditory receptor cell development
          branching involved in salivary gland morphogenesis
          lung-associated mesenchyme development
          regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling
          regulation of stem cell proliferation
          positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway
          positive regulation of endothelial cell chemotaxis to fibroblast growth factor
          regulation of extrinsic apoptotic signaling pathway in absence of ligand
          glycoprotein binding
          protein tyrosine kinase activity
          fibroblast growth factor-activated receptor activity
          Ras guanyl-nucleotide exchange factor activity
          protein binding
          ATP binding
          heparin binding
          1-phosphatidylinositol-3-kinase activity
          fibroblast growth factor binding
          protein complex binding
          identical protein binding
          protein homodimerization activity
          phosphatidylinositol-4,5-bisphosphate 3-kinase activity
          cell adhesion molecule binding

          Back To Top

          관련 제품

          • TaqMan® Genotyping Master Mix
          온라인 주문 Plus Icon Minus Icon
          • 주문 현황
          • 주문 지원
          • 빠른 주문
          • Supply Center
          • eProcurement
          지원 Plus Icon Minus Icon
          • Help and Support
          • 고객 센터
          • 기술 지원 센터
          • 제품 문서 검색
          • 사이트 문제 보고
          교육 및 이벤트 Plus Icon Minus Icon
          • 교육 센터
          • 프로모션
          • 이벤트 및 웨비나
          • 소셜 미디어
          About Thermo Fisher Plus Icon Minus Icon
          • 소개 소개
          • 채용 채용
          • 투자자 투자자
          • 뉴스 뉴스
          • 사회적 책임 사회적 책임
          • Trademarks
          • 공정거래 공정거래
          • 정책 및 고지
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • 이용 약관
          • 개인정보 처리방침
          • 가격 및 운임 정책
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Korea flag icon
          Korea

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          써모 피셔 사이언티픽 코리아 주식회사
          대표자 : 석수진
          사업자 등록번호 : 117-81-46910
          입금계좌 : 하나은행 336-890014-06204
          (예금주 : 써모피셔사이언티픽코리아 주식회사)

           

          써모 피셔 사이언티픽 솔루션스 유한회사
          대표자 : 석수진
          사업자 등록번호 : 114-86-04783
          입금계좌 : 신한은행 140-004-396660
          (예금주 : 써모피셔사이언티픽솔루션스 유한회사)

           

          주소 : 서울시 강남구 광평로 281 수서오피스빌딩 12층 06349 | 통신판매업신고번호 : 2015-서울강남-00898

          ISMS Logo

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-d59m7:80/100.66.79.221:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0