Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_11711720C_30
          See other ABCB1 GT Assays ›
          SNP ID:
          rs2032582
          Gene
          ABCB1
          Gene Name
          ATP binding cassette subfamily B member 1
          Set Membership:
          > HapMap > DME > Validated > Inventoried
          Chromosome Location:
          Chr.7: 87531302 - 87531302 on Build GRCh38
          Polymorphism:
          C/A, Transversion substitution
          Context Sequence [VIC/FAM]:

          TATTTAGTTTGACTCACCTTCCCAG[C/A]ACCTTCTAGTTCTTTCTTATCTTTC

          Assay ID C_11711720C_30
          Size 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 171050

          Literature Links:

          ABCB1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian
          C (0.44)
          (0.56)
          CEPH (CEU)
          T (0.47)
          (0.53)
          EAS - Not Available Caucasian
          T (0.07)
          (0.93)
          YRI (Yoruba) - Not Available
          SAS - Not Available African American
          A (0.08)
          (0.92)
          JPT (Japanese)
          G (0.45)
          (0.55)
          AFR - Not Available African American
          T (0.00)
          (1.00)
          CHB (Han Chinese)
          G (0.38)
          (0.62)
          EUR - Not Available Japanese
          C (0.43)
          (0.57)
          AMR - Not Available Japanese
          T (0.12)
          (0.88)
          Chinese
          A (0.36)
          (0.64)
          Chinese
          T (0.11)
          (0.89)
          ABCB1 - ATP binding cassette subfamily B member 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000927.4 3170 Missense Mutation NP_000918.2

          Back To Top

          More Information


          Important Information

          Assay C_11711720C_30 reports the major (C) and one minor (A) allele of a triallelic SNP. Assay C_11711720D_40 reports the major (C) and other minor (T) allele. Each allele of rs2032582 is found with relatively high frequency in different populations, thus both assays are required to accurately determine sample genotypes. Use of just one assay will lead to incorrect genotype calls. Run both assays separately on the same samples and analyze data as described in the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 5 section 'TaqMan DME genotyping assays to triallelic SNPs and adjacent SNP targets'.
          Assay C_11711720D_40 reports the major (C) and other minor (T) allele.

          Set Membership:

          HapMap DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          ATP-binding cassette (ABC) transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          G2/M transition of mitotic cell cycle
          antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent
          antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent
          antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent
          positive regulation of antigen processing and presentation of peptide antigen via MHC class I
          transport
          drug transmembrane transport
          response to drug
          xenobiotic transport
          transmembrane transport
          stem cell proliferation
          transporter activity
          protein binding
          ATP binding
          xenobiotic-transporting ATPase activity
          ATPase activity, coupled to transmembrane movement of substances

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-t4kr2:80/100.66.77.141:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0