Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
CCCACAAATGCAGGATACGTGATTC[A/G]TGAAACATCTAAAGGGTGAGAAAAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615165 MIM: 604972 | ||||||||||||||||||||
Literature Links: |
AKIRIN2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AKIRIN2 - akirin 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ORC3 - origin recognition complex subunit 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001197259.1 | Intron | NP_001184188.1 | ||||
NM_012381.3 | Intron | NP_036513.2 | ||||
NM_181837.2 | Intron | NP_862820.1 | ||||
XM_005248704.1 | Intron | XP_005248761.1 | ||||
XM_005248705.1 | Intron | XP_005248762.1 | ||||
XM_005248706.1 | Intron | XP_005248763.1 | ||||
XM_011535651.1 | Intron | XP_011533953.1 | ||||
XM_011535652.2 | Intron | XP_011533954.1 | ||||
XM_017010632.1 | Intron | XP_016866121.1 | ||||
XM_017010633.1 | Intron | XP_016866122.1 | ||||
XM_017010634.1 | Intron | XP_016866123.1 | ||||
XM_017010635.1 | Intron | XP_016866124.1 | ||||
XM_017010636.1 | Intron | XP_016866125.1 | ||||
XM_017010637.1 | Intron | XP_016866126.1 | ||||
XM_017010638.1 | Intron | XP_016866127.1 | ||||
XM_017010639.1 | Intron | XP_016866128.1 | ||||
XM_017010640.1 | Intron | XP_016866129.1 |