Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_151571949_10
          See other TPK1 GT Assays ›
          SNP ID:
          rs113536847
          Gene
          TPK1
          Gene Name
          thiamin pyrophosphokinase 1
          Set Membership:
          -
          Chromosome Location:
          Chr.7: 144453614 - 144453614 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CCACAGTCACAACACCAGACCCGTC[A/G]TAGGTATTGGAAGTACTGACCAATG

          Assay ID C_151571949_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 606370

          Literature Links:

          TPK1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          A (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.00)
          (1.00)
          AMR
          A (0.00)
          (1.00)
          TPK1 - thiamin pyrophosphokinase 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001042482.1 995 Silent Mutation TAC,TAT Y,Y 172 NP_001035947.1
          NM_022445.3 995 Silent Mutation TAC,TAT Y,Y 221 NP_071890.2
          XM_005249970.1 995 Silent Mutation TAC,TAT Y,Y 221 XP_005250027.1
          XM_011516031.1 995 Silent Mutation TAC,TAT Y,Y 247 XP_011514333.1
          XM_011516032.2 995 Silent Mutation TAC,TAT Y,Y 247 XP_011514334.1
          XM_011516033.2 995 Silent Mutation TAC,TAT Y,Y 247 XP_011514335.1
          XM_011516034.2 995 Silent Mutation TAC,TAT Y,Y 247 XP_011514336.1
          XM_011516035.2 995 UTR 3 XP_011514337.1
          XM_011516037.2 995 Silent Mutation TAC,TAT Y,Y 242 XP_011514339.1
          XM_011516039.2 995 Silent Mutation TAC,TAT Y,Y 221 XP_011514341.1
          XM_011516040.2 995 Intron XP_011514342.1
          XM_011516041.2 995 Silent Mutation TAC,TAT Y,Y 216 XP_011514343.1
          XM_011516043.1 995 Silent Mutation TAC,TAT Y,Y 198 XP_011514345.1
          XM_011516044.1 995 Silent Mutation TAC,TAT Y,Y 167 XP_011514346.1
          XM_011516046.1 995 Intron XP_011514348.1
          XM_011516047.2 995 Silent Mutation TAC,TAT Y,Y 115 XP_011514349.1
          XM_011516048.1 995 Silent Mutation TAC,TAT Y,Y 115 XP_011514350.1
          XM_011516050.1 995 Silent Mutation TAC,TAT Y,Y 115 XP_011514352.1
          XM_017011969.1 995 Intron XP_016867458.1
          XM_017011970.1 995 Silent Mutation TAC,TAT Y,Y 242 XP_016867459.1
          XM_017011971.1 995 Silent Mutation TAC,TAT Y,Y 242 XP_016867460.1
          XM_017011972.1 995 Intron XP_016867461.1
          XM_017011973.1 995 Silent Mutation TAC,TAT Y,Y 221 XP_016867462.1
          XM_017011974.1 995 Silent Mutation TAC,TAT Y,Y 221 XP_016867463.1
          XM_017011975.1 995 Silent Mutation TAC,TAT Y,Y 221 XP_016867464.1
          XM_017011976.1 995 UTR 3 XP_016867465.1
          XM_017011977.1 995 Silent Mutation TAC,TAT Y,Y 216 XP_016867466.1
          XM_017011978.1 995 Silent Mutation TAC,TAT Y,Y 216 XP_016867467.1
          XM_017011979.1 995 Silent Mutation TAC,TAT Y,Y 172 XP_016867468.1
          XM_017011980.1 995 Silent Mutation TAC,TAT Y,Y 141 XP_016867469.1
          XM_017011981.1 995 Silent Mutation TAC,TAT Y,Y 141 XP_016867470.1
          XM_017011982.1 995 Silent Mutation TAC,TAT Y,Y 115 XP_016867471.1
          XM_017011983.1 995 Silent Mutation TAC,TAT Y,Y 115 XP_016867472.1
          XM_017011984.1 995 Silent Mutation TAC,TAT Y,Y 115 XP_016867473.1
          XM_017011985.1 995 Silent Mutation TAC,TAT Y,Y 115 XP_016867474.1
          XM_017011986.1 995 Silent Mutation TAC,TAT Y,Y 115 XP_016867475.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          kinase

          Gene Ontology Categories:

          Function(s) Process(es)

          thiamine metabolic process
          thiamine diphosphate biosynthetic process
          phosphorylation
          thiamine-containing compound metabolic process
          thiamine diphosphokinase activity
          ATP binding
          kinase activity
          thiamine binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-5cvsx:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline