Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_151693869_10
          See other CFTR GT Assays ›
          SNP ID:
          rs113993960
          Gene
          CFTR
          Gene Name
          cystic fibrosis transmembrane conductance regulator
          Set Membership:
          > Qualified
          Chromosome Location:
          Chr.7: 117559592 - 117559594 on Build GRCh38
          Polymorphism:
          -/CTT, Insertion/deletion
          Context Sequence [VIC/FAM]:

          TGGCACCATTAAAGAAAATATCAT[-/CTT]TGGTGTTTCCTATGATGAATATAG

          Assay ID C_151693869_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602421

          Literature Links:

          CFTR PubMed Links

          Allele Nomenclature:

          CFTR c.1521_1523delCTT,p.Phe508del c.1521_1523delCTT F508del

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          - (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          - (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          - (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          - (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          - (0.01)
          (0.99)
          AMR
          - (0.01)
          (0.99)
          CFTR - cystic fibrosis transmembrane conductance regulator
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000492.3 2718 Silent Mutation NP_000483.3
          XM_011515751.2 2718 Frame Shift Delete XP_011514053.1
          XM_011515753.1 2718 Frame Shift Delete XP_011514055.1
          XM_011515754.2 2718 Frame Shift Delete XP_011514056.1
          XM_017011699.1 2718 Frame Shift Delete XP_016867188.1

          Back To Top

          More Information


          Set Membership:

          Qualified

          Panther Classification:

          Molecular Function -

          ATP-binding cassette (ABC) transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          cholesterol biosynthetic process
          transport
          vesicle docking involved in exocytosis
          respiratory gaseous exchange
          bicarbonate transport
          cholesterol transport
          positive regulation of insulin secretion involved in cellular response to glucose stimulus
          positive regulation of exocytosis
          sperm capacitation
          intracellular pH elevation
          transmembrane transport
          membrane hyperpolarization
          cellular response to cAMP
          positive regulation of cyclic nucleotide-gated ion channel activity
          chloride transmembrane transport
          positive regulation of voltage-gated chloride channel activity
          ATP-binding and phosphorylation-dependent chloride channel activity
          chloride channel activity
          channel-conductance-controlling ATPase activity
          protein binding
          ATP binding
          bicarbonate transmembrane transporter activity
          chloride transmembrane transporter activity
          chloride channel regulator activity
          chloride channel inhibitor activity
          enzyme binding
          PDZ domain binding
          anion transmembrane-transporting ATPase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Spain flag icon
          Spain

          TEST

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-b2k9d:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline