Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Instrument Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • Our Instagram
      Our Instagram
    • Our Facebook
      Our Facebook
    • Blog Behind the Bench
      Blog Behind the Bench
    • Customer Experience Center (CEC)
      Customer Experience Center (CEC)
    • Ecommerce Exclusives
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_151693869_10
          See other CFTR GT Assays ›
          SNP ID:
          rs113993960
          Gene
          CFTR
          Gene Name
          cystic fibrosis transmembrane conductance regulator
          Set Membership:
          > Qualified
          Chromosome Location:
          Chr.7: 117559592 - 117559594 on Build GRCh38
          Polymorphism:
          -/CTT, Insertion/deletion
          Context Sequence [VIC/FAM]:

          TGGCACCATTAAAGAAAATATCAT[-/CTT]TGGTGTTTCCTATGATGAATATAG

          Assay ID C_151693869_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602421

          Literature Links:

          CFTR PubMed Links

          Allele Nomenclature:

          CFTR c.1521_1523delCTT,p.Phe508del c.1521_1523delCTT F508del

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          - (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          - (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          - (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          - (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          - (0.01)
          (0.99)
          AMR
          - (0.01)
          (0.99)
          CFTR - cystic fibrosis transmembrane conductance regulator
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000492.3 2718 Silent Mutation NP_000483.3
          XM_011515751.2 2718 Frame Shift Delete XP_011514053.1
          XM_011515753.1 2718 Frame Shift Delete XP_011514055.1
          XM_011515754.2 2718 Frame Shift Delete XP_011514056.1
          XM_017011699.1 2718 Frame Shift Delete XP_016867188.1

          Back To Top

          More Information


          Set Membership:

          Qualified

          Panther Classification:

          Molecular Function -

          ATP-binding cassette (ABC) transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          cholesterol biosynthetic process
          transport
          vesicle docking involved in exocytosis
          respiratory gaseous exchange
          bicarbonate transport
          cholesterol transport
          positive regulation of insulin secretion involved in cellular response to glucose stimulus
          positive regulation of exocytosis
          sperm capacitation
          intracellular pH elevation
          transmembrane transport
          membrane hyperpolarization
          cellular response to cAMP
          positive regulation of cyclic nucleotide-gated ion channel activity
          chloride transmembrane transport
          positive regulation of voltage-gated chloride channel activity
          ATP-binding and phosphorylation-dependent chloride channel activity
          chloride channel activity
          channel-conductance-controlling ATPase activity
          protein binding
          ATP binding
          bicarbonate transmembrane transporter activity
          chloride transmembrane transporter activity
          chloride channel regulator activity
          chloride channel inhibitor activity
          enzyme binding
          PDZ domain binding
          anion transmembrane-transporting ATPase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Find Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Brasil flag icon
          Brasil

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-zsnhf:80/100.66.75.14:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline