Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_153104857_10
          See other LOC100287042 GT Assays ›
          SNP ID:
          rs113513403
          Gene
          LOC100287042 MIF4GD MRPS7 SLC25A19
          Gene Name
          uncharacterized LOC100287042
          MIF4G domain containing
          mitochondrial ribosomal protein S7
          solute carrier family 25 member 19
          Set Membership:
          -
          Chromosome Location:
          Chr.17: 75273496 - 75273496 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TGTTCATGCAGTGGAAGACATTACA[A/G]AAGAATTCATACGAGAAGAACATGA

          Assay ID C_153104857_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 612072 MIM: 611974 MIM: 606521

          Literature Links:

          LOC100287042 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          LOC100287042 - uncharacterized LOC100287042
          There are no transcripts associated with this gene.
          MIF4GD - MIF4G domain containing
          There are no transcripts associated with this gene.
          MRPS7 - mitochondrial ribosomal protein S7
          There are no transcripts associated with this gene.
          SLC25A19 - solute carrier family 25 member 19
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001126121.1 1335 Silent Mutation TTC,TTT F,F 306 NP_001119593.1
          NM_001126122.1 1335 Silent Mutation TTC,TTT F,F 306 NP_001119594.1
          NM_021734.4 1335 Silent Mutation TTC,TTT F,F 306 NP_068380.3
          XM_005257559.3 1335 Silent Mutation TTC,TTT F,F 306 XP_005257616.1
          XM_005257560.2 1335 Silent Mutation TTC,TTT F,F 306 XP_005257617.1
          XM_005257561.3 1335 Silent Mutation TTC,TTT F,F 306 XP_005257618.1
          XM_005257562.2 1335 Silent Mutation TTC,TTT F,F 306 XP_005257619.1
          XM_006722007.2 1335 Silent Mutation TTC,TTT F,F 306 XP_006722070.1
          XM_011525098.1 1335 Silent Mutation TTC,TTT F,F 201 XP_011523400.1
          XM_017024926.1 1335 Silent Mutation TTC,TTT F,F 306 XP_016880415.1
          XM_017024927.1 1335 Silent Mutation TTC,TTT F,F 205 XP_016880416.1
          XM_017024928.1 1335 Silent Mutation TTC,TTT F,F 201 XP_016880417.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          mitochondrial carrier protein

          Gene Ontology Categories:

          Function(s) Process(es)

          positive regulation of defense response to virus by host
          translation
          deoxynucleotide transport
          transmembrane transport
          xenophagy
          structural constituent of ribosome
          deoxynucleotide transmembrane transporter activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-fcf5f9d6d-ff6sw:80/100.66.79.169:80.
          git-commit: 856de8fa7eff2d55603d92afdf035972e45c3e8a
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.51.0-2026.05.21-1.0