Search
LOADING 
- SNP ID:
- rs112397317
- Gene
-
DOT1LLOC105372239MIR1227MIR6789PLEKHJ1SF3A2 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.19: 2230594 - 2230594 on Build GRCh38
- Polymorphism:
- C/T, Transition substitution
- Context Sequence [VIC/FAM]:
GCCCTGCGATGCGGGGCAGGCCTGT[C/T]GTGGGTCCCTTGGTGTTTCTGTACA
Genomic Map
Back To TopAssay 상세 정보
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607375
MIM: 600796
|
||||||||||||||||||||||||||||||||||||||
Literature Links: |
DOT1L PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap | |||
|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
| DOT1L - DOT1 like histone lysine methyltransferase | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_032482.2 | 7539 | UTR 3 | NP_115871.1 | |||
| XM_005259659.3 | 7539 | UTR 3 | XP_005259716.1 | |||
| XM_005259660.3 | 7539 | UTR 3 | XP_005259717.1 | |||
| XM_011528359.2 | 7539 | UTR 3 | XP_011526661.1 | |||
| XM_011528360.1 | 7539 | UTR 3 | XP_011526662.1 | |||
| XM_011528361.2 | 7539 | UTR 3 | XP_011526663.1 | |||
| XM_017027366.1 | 7539 | UTR 3 | XP_016882855.1 | |||
| LOC105372239 - uncharacterized LOC105372239 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| MIR1227 - microRNA 1227 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| MIR6789 - microRNA 6789 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| PLEKHJ1 - pleckstrin homology domain containing J1 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001300836.1 | 7539 | Missense Mutation | AAC,GAC | N,D 135 | NP_001287765.1 | |
| NM_018049.2 | 7539 | Intron | NP_060519.1 | |||
| XM_017026924.1 | 7539 | Intron | XP_016882413.1 | |||
| XM_017026925.1 | 7539 | Intron | XP_016882414.1 | |||
| XM_017026926.1 | 7539 | Intron | XP_016882415.1 | |||
| XM_017026927.1 | 7539 | Intron | XP_016882416.1 | |||
| XM_017026928.1 | 7539 | Intron | XP_016882417.1 | |||
| SF3A2 - splicing factor 3a subunit 2 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To Top