Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture and Transfection
    • Chemicals
    • Chromatography
    • Electron Microscopes
    • Lab Plasticware and Supplies
    • Lab Centrifuges
    • Lab Solutions
    • Mass Spectrometers
    • Next Generation Sequencers
    • See all product categories
  • Applications
    • Brands
    • Industrial and Applied Sciences
    • Food and Beverage
    • Forensics
    • Lab Solutions
    • Life Sciences
    • Pharma and Biopharma
    • Biotechnology
    • Clinical and Diagnostics
    • Digital Solutions
    • See all applications
  • Services
    • Lab Instrument and Equipment Services
    • Custom Services
    • Training Services
    • Financial and Leasing Services
    • Enterprise Level Lab Informatics
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Cell Biology Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • Contact Us
    • Product Documentation
    • Knowledge Base and Product FAQs
    • Learning Centers
    • Supply Center
    • eProcurement Solutions
    • Lab Instrument and Equipment Support
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_154270519_10
          See other LINC01126 GT Assays ›
          SNP ID:
          rs113541137
          Gene
          LINC01126 THADA ZFP36L2
          Gene Name
          long intergenic non-protein coding RNA 1126
          THADA, armadillo repeat containing
          ZFP36 ring finger protein like 2
          Set Membership:
          -
          Chromosome Location:
          Chr.2: 43223955 - 43223955 on Build GRCh38
          Polymorphism:
          G/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          TGGTGCTGGGTTGATTTTTCCTGAA[G/T]TCCCAAACTCATCGGAGTCCTAACA

          Assay ID C_154270519_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 611800 MIM: 612053

          Literature Links:

          LINC01126 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          LINC01126 - long intergenic non-protein coding RNA 1126
          There are no transcripts associated with this gene.
          THADA - THADA, armadillo repeat containing
          There are no transcripts associated with this gene.
          ZFP36L2 - ZFP36 ring finger protein like 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_006887.4 2140 UTR 3 NP_008818.3

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          RNA metabolism protein

          Gene Ontology Categories:

          Function(s) Process(es)

          nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay
          regulation of transcription, DNA-templated
          mRNA catabolic process
          cell proliferation
          response to wounding
          hemopoiesis
          T cell differentiation in thymus
          somatic stem cell population maintenance
          regulation of mRNA stability
          cellular response to fibroblast growth factor stimulus
          negative regulation of fat cell differentiation
          somatic stem cell division
          definitive hemopoiesis
          3'-UTR-mediated mRNA destabilization
          ERK1 and ERK2 cascade
          cellular response to tumor necrosis factor
          cellular response to epidermal growth factor stimulus
          cellular response to glucocorticoid stimulus
          cellular response to transforming growth factor beta stimulus
          cellular response to granulocyte macrophage colony-stimulating factor stimulus
          positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay
          cellular response to phorbol 13-acetate 12-myristate
          negative regulation of stem cell differentiation
          DNA binding
          transcription factor activity, sequence-specific DNA binding
          mRNA 3'-UTR binding
          protein binding
          AU-rich element binding
          mRNA 3'-UTR AU-rich region binding
          poly(A) RNA binding
          metal ion binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Quick Order
          • eProcurement
          • Supply Center
          • Order Status
          • Chemicals
          • India Mobile App
          • Government eMarketplace
          Support Plus Icon Minus Icon
          • Order Support
          • Training
          • Contact Us
          • Report a Site Issue
          • Instrument Management
          Resources Plus Icon Minus Icon
          • Product Selection Guides
          • Mobile & Desktop Apps
          • Webinars
          • Blog 
          • Social Media
          • New Products
          • Promotions
          • Shared Lists
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          India flag icon
          India

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline