Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
CAATGGCATCGAGGTCTACAGTACC[A/G]AAATCAACTCCAAGGTGACCTCCCG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 147270 MIM: 146650 | |||||||||||||||||||||||
Literature Links: |
ITIH1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
ITIH1 - inter-alpha-trypsin inhibitor heavy chain 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ITIH3 - inter-alpha-trypsin inhibitor heavy chain 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002217.3 | 181 | Missense Mutation | AAA,GAA | K,E 49 | NP_002208.3 | |
XM_005265105.4 | 181 | Missense Mutation | AAA,GAA | K,E 49 | XP_005265162.1 | |
XM_017006356.1 | 181 | UTR 5 | XP_016861845.1 |