Hamburger Menu Button
Thermo Fisher Scientific Logo
Faça o login
Não tem uma conta? Criar Conta​
  • Produtos
    • Consumíveis de Laboratório
    • Equipamentos de Laboratório
    • Instrumentos de Laboratório
    • Clínica & Diagnóstico
    • Cromatografia
    • Espectrômetria de Massas
    • Cultura Celular
    • Análise Celular
    • Anticorpos
    • Biologia Molecular & Análise de Ácidos Nucleicos
    • Produtos Ácidos Nucleicos Específicos de Sequência
    • Veja todas as categorias de produtos
  • Aplicações
    • Cultura Celular e Transfecção
    • Citometria de Fluxo
    • Pesquisa em Oncologia
    • Cromatografia
    • Sequenciamento
    • PCR
    • Soluções Laboratoriais
    • Diagnóstico de Alergias
    • Veja todas as aplicações e técnicas
  • Serviços
    • Serviços de Instrumentos e Equipamentos de Laboratório
    • Serviços Personalizados
    • Serviços de Treinamento
    • Serviços Empresariais
    • Informática de Laboratório em Nível Empresarial
    • Serviços Financeiros e de Arrendamento
    • CDMO & Serviços de Ensaios Clínicos
    • Veja todas as serviços
  • Ajuda e suporte
    • Cadastre-se em nosso site
    • Como fazer o pedido
    • Entre em Contato Conosco
    • Mudança de Localização do Site
    • Veja todos os tópicos de ajuda e suporte
  • Popular
    • Our Instagram
      Nosso Instagram
    • Our Facebook
      Nosso Facebook
    • Blog Behind the Bench
      Blog Behind the Bench
    • Customer Experience Center (CEC)
      Customer Experience Center (CEC)
    • Ecommerce Exclusives
  • Ofertas especiais
  • Fale Conosco
  • Pedido rápido
  • Documentos e certificados
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Fale Conosco
          • Pedido rápido
          • Faça o login
            Faça o login
            Não tem uma conta? Criar Conta​
            • Conta
            • Status do pedido
            • Produtos Customizados & Projetos
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_160349444_10
          See other ACBD5 GT Assays ›
          SNP ID:
          rs139046358
          Gene
          ACBD5 ARMC4P1 LRRC37A6P
          Gene Name
          acyl-CoA binding domain containing 5
          armadillo repeat containing 4 pseudogene 1
          leucine rich repeat containing 37 member A6, pseudogene
          Set Membership:
          -
          Chromosome Location:
          Chr.10: 27248206 - 27248206 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TGCCATTGCTGTCTGAGGCTGCCTC[C/T]GGCTCAATAGTCAGCTCAGTGCTCG

          Assay ID C_160349444_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 616618

          Literature Links:

          ACBD5 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.01)
          (0.99)
          AMR
          T (0.00)
          (1.00)
          ACBD5 - acyl-CoA binding domain containing 5
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001042473.3 469 Intron NP_001035938.1
          NM_001271512.3 469 Intron NP_001258441.1
          NM_001301251.1 469 Intron NP_001288180.1
          NM_001301252.1 469 Intron NP_001288181.1
          NM_001301253.1 469 Intron NP_001288182.1
          NM_001301254.1 469 Intron NP_001288183.1
          NM_145698.4 469 Intron NP_663736.2
          XM_006717528.3 469 UTR 5 XP_006717591.3
          XM_006717530.3 469 Intron XP_006717593.1
          XM_006717531.2 469 Intron XP_006717594.1
          XM_006717535.2 469 Intron XP_006717598.1
          XM_017016884.1 469 UTR 5 XP_016872373.1
          XM_017016885.1 469 UTR 5 XP_016872374.1
          XM_017016886.1 469 UTR 5 XP_016872375.1
          XM_017016887.1 469 Intron XP_016872376.1
          XM_017016888.1 469 Intron XP_016872377.1
          XM_017016889.1 469 Intron XP_016872378.1
          XM_017016890.1 469 UTR 5 XP_016872379.1
          XM_017016891.1 469 Intron XP_016872380.1
          XM_017016892.1 469 Intron XP_016872381.1
          XM_017016893.1 469 UTR 5 XP_016872382.1
          XM_017016894.1 469 UTR 5 XP_016872383.1
          XM_017016895.1 469 Intron XP_016872384.1
          XM_017016896.1 469 Intron XP_016872385.1
          XM_017016897.1 469 Intron XP_016872386.1
          XM_017016898.1 469 Intron XP_016872387.1
          XM_017016899.1 469 Intron XP_016872388.1
          XM_017016900.1 469 Intron XP_016872389.1
          XM_017016901.1 469 Intron XP_016872390.1
          XM_017016902.1 469 Intron XP_016872391.1
          XM_017016903.1 469 Intron XP_016872392.1
          XM_017016904.1 469 Intron XP_016872393.1
          XM_017016905.1 469 Intron XP_016872394.1
          XM_017016906.1 469 Intron XP_016872395.1
          XM_017016907.1 469 Intron XP_016872396.1
          XM_017016908.1 469 Intron XP_016872397.1
          ARMC4P1 - armadillo repeat containing 4 pseudogene 1
          There are no transcripts associated with this gene.
          LRRC37A6P - leucine rich repeat containing 37 member A6, pseudogene
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          transfer/carrier protein

          Gene Ontology Categories:

          Function(s) Process(es)

          transport
          macroautophagy
          pexophagy
          aggrephagy
          fatty-acyl-CoA binding
          molecular_function
          lipid binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Status do pedido
          • Ajuda para pedidos
          • Pedido rápido
          • Supply Center
          • eProcurement
          Suporte Plus Icon Minus Icon
          • Ajuda e suporte
          • Entre em Contato
          • Centros de Suporte Técnico
          • Obter Documentos e Certificados
          • Informe um Problema no Site
          Recursos Plus Icon Minus Icon
          • Centros de aprendizagem
          • Promoções
          • Eventos & Webinars
          • Mídia Sociais
          Sobre a Thermo Fisher Plus Icon Minus Icon
          • Sobre Nós Sobre Nós
          • Carreiras Carreiras
          • Investidores Investidores
          • Sala de Impresa Sala de Impresa
          • Responsabilidade Social Responsabilidade Social
          • Marcas
          • Políticas e avisos
          Nosso Portfólio Plus Icon Minus Icon
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Brasil flag icon
          Brasil

          Your items have has been added!


          Host server : magellan-search-green-55658555d6-nww8l:80/100.66.79.224:80.
          git-commit: ec8e7df5f8fec8d765bd419205f1b5046a016d37
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.41.0-Offline