Search Thermo Fisher Scientific
- Contáctenos
- Orden Rápida
-
¿No tiene una cuenta? Crear una cuenta
Search Thermo Fisher Scientific
TCTATGCACTATATAATAACTGGGA[G/A]CACATGAAAGGCTCCTTGCTCCAAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601984 MIM: 605034 | ||||||||||||||||||||
Literature Links: |
NCOA4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NCOA4 - nuclear receptor coactivator 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TIMM23 - translocase of inner mitochondrial membrane 23 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006327.3 | 766 | Missense Mutation | NP_006318.1 | |||
XM_011539098.1 | 766 | Intron | XP_011537400.1 | |||
XM_011539099.1 | 766 | Intron | XP_011537401.1 |