Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Servicios para Empresas
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_160449904_10
          See other CTBP2 GT Assays ›
          SNP ID:
          rs141252590
          Gene
          CTBP2 ZRANB1
          Gene Name
          C-terminal binding protein 2
          zinc finger RANBP2-type containing 1
          Set Membership:
          -
          Chromosome Location:
          Chr.10: 124989691 - 124989691 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CCTGGAGCCACACCCACGATGCCTG[A/G]CGGATATCTAAGGAACACACAGAAA

          Assay ID C_160449904_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602619 MIM: 611749

          Literature Links:

          CTBP2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          CTBP2 - C-terminal binding protein 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001083914.2 3373 Intron NP_001077383.1
          NM_001290214.2 3373 Intron NP_001277143.1
          NM_001290215.2 3373 Missense Mutation CCA,TCA P,S 389 NP_001277144.1
          NM_001321012.1 3373 Missense Mutation CCA,TCA P,S 389 NP_001307941.1
          NM_001321013.1 3373 Missense Mutation CCA,TCA P,S 389 NP_001307942.1
          NM_001321014.1 3373 Missense Mutation CCA,TCA P,S 389 NP_001307943.1
          NM_001329.3 3373 Intron NP_001320.1
          NM_022802.2 3373 Missense Mutation CCA,TCA P,S 929 NP_073713.2
          XM_005269561.2 3373 Missense Mutation CCA,TCA P,S 389 XP_005269618.1
          XM_005269564.2 3373 Missense Mutation CCA,TCA P,S 389 XP_005269621.1
          XM_005269567.2 3373 Missense Mutation CCA,TCA P,S 389 XP_005269624.1
          XM_005269568.4 3373 Missense Mutation CCA,TCA P,S 389 XP_005269625.1
          XM_005269569.2 3373 Missense Mutation CCA,TCA P,S 389 XP_005269626.1
          XM_005269571.2 3373 Missense Mutation CCA,TCA P,S 389 XP_005269628.1
          XM_005269572.3 3373 Missense Mutation CCA,TCA P,S 389 XP_005269629.1
          XM_006717642.2 3373 Missense Mutation CCA,TCA P,S 389 XP_006717705.1
          XM_011539349.2 3373 Missense Mutation CCA,TCA P,S 457 XP_011537651.1
          XM_011539351.1 3373 Missense Mutation CCA,TCA P,S 389 XP_011537653.1
          XM_011539353.1 3373 Missense Mutation CCA,TCA P,S 389 XP_011537655.1
          XM_011539354.1 3373 Missense Mutation CCA,TCA P,S 389 XP_011537656.1
          XM_011539355.1 3373 Missense Mutation CCA,TCA P,S 389 XP_011537657.1
          XM_011539357.1 3373 Missense Mutation CCA,TCA P,S 364 XP_011537659.1
          XM_011539358.1 3373 Missense Mutation CCA,TCA P,S 364 XP_011537660.1
          XM_017015756.1 3373 Missense Mutation CCA,TCA P,S 389 XP_016871245.1
          XM_017015757.1 3373 Missense Mutation CCA,TCA P,S 389 XP_016871246.1
          ZRANB1 - zinc finger RANBP2-type containing 1
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          transcription cofactor

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          transcription, DNA-templated
          negative regulation of cell proliferation
          viral genome replication
          positive regulation of chromatin binding
          negative regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          positive regulation of retinoic acid receptor signaling pathway
          white fat cell differentiation
          oxidation-reduction process
          chromatin binding
          transcription coactivator activity
          transcription corepressor activity
          protein binding
          oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor
          protein homodimerization activity
          retinoic acid receptor binding
          NAD binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-5688f:80/100.66.73.65:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0