Search
LOADING 
- SNP ID:
- rs143010464
- Gene
-
PPP3CBPPP3CB-AS1USP54 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.10: 73499079 - 73499079 on Build GRCh38
- Polymorphism:
- A/G, Transition substitution
- Context Sequence [VIC/FAM]:
GTGCCCAGGAGTTGTCTGTTCTGGA[A/G]CGATGGGGGAGGCTCTGGTAGTTCA
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 114106
|
||||||||||||||||||||||||||||||||||||||
Literature Links: |
PPP3CB PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap | |||
|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
| PPP3CB - protein phosphatase 3 catalytic subunit beta | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| PPP3CB-AS1 - PPP3CB antisense RNA 1 (head to head) | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| USP54 - ubiquitin specific peptidase 54 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001320437.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1473 | NP_001307366.1 | |
| NM_001320441.1 | 4509 | Intron | NP_001307370.1 | |||
| NM_152586.3 | 4509 | Silent Mutation | CGC,CGT | R,R 1535 | NP_689799.3 | |
| XM_005269582.2 | 4509 | Silent Mutation | CGC,CGT | R,R 1431 | XP_005269639.1 | |
| XM_011539368.2 | 4509 | Silent Mutation | CGC,CGT | R,R 1500 | XP_011537670.1 | |
| XM_017015759.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1559 | XP_016871248.1 | |
| XM_017015760.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1559 | XP_016871249.1 | |
| XM_017015761.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1559 | XP_016871250.1 | |
| XM_017015762.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1559 | XP_016871251.1 | |
| XM_017015763.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1559 | XP_016871252.1 | |
| XM_017015764.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1559 | XP_016871253.1 | |
| XM_017015765.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1559 | XP_016871254.1 | |
| XM_017015766.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1559 | XP_016871255.1 | |
| XM_017015767.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1559 | XP_016871256.1 | |
| XM_017015768.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1559 | XP_016871257.1 | |
| XM_017015769.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1559 | XP_016871258.1 | |
| XM_017015770.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1559 | XP_016871259.1 | |
| XM_017015771.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1557 | XP_016871260.1 | |
| XM_017015772.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1554 | XP_016871261.1 | |
| XM_017015773.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1537 | XP_016871262.1 | |
| XM_017015774.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1535 | XP_016871263.1 | |
| XM_017015775.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1535 | XP_016871264.1 | |
| XM_017015776.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1535 | XP_016871265.1 | |
| XM_017015777.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1535 | XP_016871266.1 | |
| XM_017015778.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1519 | XP_016871267.1 | |
| XM_017015779.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1512 | XP_016871268.1 | |
| XM_017015780.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1507 | XP_016871269.1 | |
| XM_017015781.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1502 | XP_016871270.1 | |
| XM_017015782.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1495 | XP_016871271.1 | |
| XM_017015783.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1478 | XP_016871272.1 | |
| XM_017015784.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1478 | XP_016871273.1 | |
| XM_017015785.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1472 | XP_016871274.1 | |
| XM_017015786.1 | 4509 | Silent Mutation | CGC,CGT | R,R 1438 | XP_016871275.1 | |
Back To Top