Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_161030260_10
          See other CD44 GT Assays ›
          SNP ID:
          rs137859165
          Gene
          CD44
          Gene Name
          CD44 molecule (Indian blood group)
          Set Membership:
          -
          Chromosome Location:
          Chr.11: 35229219 - 35229219 on Build GRCh38
          Polymorphism:
          A/G, Transition Substitution
          Context Sequence [VIC/FAM]:

          GTGGACTCAACGGAGAGGCCAGCAA[A/G]TCTCAGGAAATGGTGCATTTGGTGA

          Assay ID C_161030260_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 107269

          Literature Links:

          CD44 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          CD44 - CD44 molecule (Indian blood group)
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000610.3 2018 Silent Mutation AAA,AAG K,K 705 NP_000601.3
          NM_001001389.1 2018 Silent Mutation AAA,AAG K,K 662 NP_001001389.1
          NM_001001390.1 2018 Silent Mutation AAA,AAG K,K 456 NP_001001390.1
          NM_001001391.1 2018 Silent Mutation AAA,AAG K,K 324 NP_001001391.1
          NM_001001392.1 2018 Missense Mutation ATC,GTC I,V 118 NP_001001392.1
          NM_001202555.1 2018 Silent Mutation AAA,AAG K,K 392 NP_001189484.1
          NM_001202556.1 2018 Silent Mutation AAA,AAG K,K 303 NP_001189485.1
          NM_001202557.1 2018 Intron NP_001189486.1
          XM_005253231.2 2018 Silent Mutation AAA,AAG K,K 706 XP_005253288.1
          XM_005253232.2 2018 Silent Mutation AAA,AAG K,K 705 XP_005253289.1
          XM_005253233.2 2018 Silent Mutation AAA,AAG K,K 666 XP_005253290.1
          XM_005253234.2 2018 Silent Mutation AAA,AAG K,K 665 XP_005253291.1
          XM_005253235.2 2018 Silent Mutation AAA,AAG K,K 663 XP_005253292.1
          XM_005253238.2 2018 Silent Mutation AAA,AAG K,K 543 XP_005253295.1
          XM_005253239.2 2018 Silent Mutation AAA,AAG K,K 541 XP_005253296.1
          XM_005253240.2 2018 Silent Mutation AAA,AAG K,K 498 XP_005253297.1
          XM_006718388.1 2018 Silent Mutation AAA,AAG K,K 704 XP_006718451.1
          XM_006718390.3 2018 Intron XP_006718453.1
          XM_011520482.1 2018 Silent Mutation AAA,AAG K,K 638 XP_011518784.1
          XM_011520483.1 2018 Silent Mutation AAA,AAG K,K 621 XP_011518785.1
          XM_011520484.1 2018 Silent Mutation AAA,AAG K,K 620 XP_011518786.1
          XM_011520485.1 2018 Silent Mutation AAA,AAG K,K 619 XP_011518787.1
          XM_011520486.1 2018 Silent Mutation AAA,AAG K,K 500 XP_011518788.1
          XM_011520487.2 2018 Intron XP_011518789.1
          XM_011520488.1 2018 Silent Mutation AAA,AAG K,K 388 XP_011518790.1
          XM_011520489.2 2018 Intron XP_011518791.1
          XM_017018583.1 2018 Silent Mutation AAA,AAG K,K 662 XP_016874072.1
          XM_017018584.1 2018 Silent Mutation AAA,AAG K,K 409 XP_016874073.1
          XM_017018585.1 2018 Silent Mutation AAA,AAG K,K 366 XP_016874074.1

          Back To Top

          More Information


          Additional Information:

          For this assay, SNP(s) [rs376706979] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

          Gene Ontology Categories:

          Function(s) Process(es)

          cell-matrix adhesion
          single organismal cell-cell adhesion
          extracellular matrix disassembly
          extracellular matrix organization
          hyaluronan catabolic process
          positive regulation of peptidyl-serine phosphorylation
          positive regulation of heterotypic cell-cell adhesion
          negative regulation of apoptotic process
          negative regulation of cysteine-type endopeptidase activity involved in apoptotic process
          negative regulation of DNA damage response, signal transduction by p53 class mediator
          cellular response to fibroblast growth factor stimulus
          positive regulation of peptidyl-tyrosine phosphorylation
          leukocyte migration
          cartilage development
          interferon-gamma-mediated signaling pathway
          positive regulation of ERK1 and ERK2 cascade
          monocyte aggregation
          positive regulation of monocyte aggregation
          negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator
          cytokine receptor activity
          protein binding
          collagen binding
          hyaluronic acid binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline