Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
GCACCAAGGAGGAGCCCGTGACAGC[C/T]GATGTCATCAACCCTATGGCCTTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605941 | ||||||||||||||||||||
Literature Links: |
SART1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
SART1 - squamous cell carcinoma antigen recognized by T-cells 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005146.4 | 580 | Silent Mutation | GCC,GCT | A,A 153 | NP_005137.1 | |
XM_011545344.1 | 580 | Silent Mutation | GCC,GCT | A,A 55 | XP_011543646.1 | |
XM_011545345.2 | 580 | UTR 5 | XP_011543647.1 |
TSGA10IP - testis specific 10 interacting protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |