Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_161920662_10
          See other TBX3 GT Assays ›
          SNP ID:
          rs142609038
          Gene
          TBX3
          Gene Name
          T-box 3
          Set Membership:
          -
          Chromosome Location:
          Chr.12: 114671868 - 114671868 on Build GRCh38
          Polymorphism:
          A/C, Transversion substitution
          Context Sequence [VIC/FAM]:

          ACGGGGACGCGCTGCGGGACCTGTC[A/C]GGCTTGGCTTCCAAGCCGCTAACCA

          Assay ID C_161920662_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 601621

          Literature Links:

          TBX3 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          A (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.00)
          (1.00)
          AMR
          A (0.00)
          (1.00)
          TBX3 - T-box 3
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_005996.3 3109 Silent Mutation CCG,CCT P,P 715 NP_005987.3
          NM_016569.3 3109 Silent Mutation CCG,CCT P,P 735 NP_057653.3

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          Rel homology transcription factor

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          skeletal system development
          blood vessel development
          in utero embryonic development
          heart looping
          outflow tract morphogenesis
          atrioventricular bundle cell differentiation
          transcription, DNA-templated
          regulation of transcription from RNA polymerase II promoter
          cell aging
          positive regulation of cell proliferation
          anterior/posterior axis specification, embryo
          organ morphogenesis
          specification of organ position
          stem cell population maintenance
          limbic system development
          male genitalia development
          female genitalia development
          negative regulation of epithelial cell differentiation
          mammary gland development
          luteinizing hormone secretion
          embryonic forelimb morphogenesis
          embryonic hindlimb morphogenesis
          forelimb morphogenesis
          embryonic digit morphogenesis
          negative regulation of apoptotic process
          negative regulation of myoblast differentiation
          positive regulation of cell cycle
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          follicle-stimulating hormone secretion
          mesoderm morphogenesis
          palate development
          ventricular septum morphogenesis
          branching involved in mammary gland duct morphogenesis
          mammary placode formation
          cardiac muscle cell fate commitment
          sinoatrial node cell development
          cellular senescence
          positive regulation of stem cell proliferation
          RNA polymerase II core promoter proximal region sequence-specific DNA binding
          transcriptional repressor activity, RNA polymerase II core promoter proximal region sequence-specific binding
          RNA polymerase II transcription factor binding
          RNA polymerase II activating transcription factor binding
          protein binding
          sequence-specific DNA binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-7d94cb4b65-jwmpg:80/100.66.76.145:80.
          git-commit: c9e08c96761173abe34e68f880379696776a4827
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.44.1-2026.02.97.1.0