Search
LOADING 
- SNP ID:
- rs146080672
- Gene
-
ARHGEF25B4GALNT1LOC101927583SLC26A10 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.12: 57624071 - 57624071 on Build GRCh38
- Polymorphism:
- A/G, Transition substitution
- Context Sequence [VIC/FAM]:
TCTGCCAGATGCAGGAACTTCCACA[A/G]CTATGGCACATCAGCCGAGTGGACT
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610215
MIM: 601873
|
||||||||||||||||||||
Literature Links: |
ARHGEF25 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| ARHGEF25 - Rho guanine nucleotide exchange factor 25 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| B4GALNT1 - beta-1,4-N-acetyl-galactosaminyltransferase 1 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001276468.1 | 1511 | Intron | NP_001263397.1 | |||
| NM_001276469.1 | 1511 | Intron | NP_001263398.1 | |||
| NM_001478.4 | 1511 | Intron | NP_001469.1 | |||
| XM_005268773.4 | 1511 | UTR 3 | XP_005268830.1 | |||
| XM_011538147.2 | 1511 | UTR 3 | XP_011536449.1 | |||
| XM_011538148.2 | 1511 | UTR 3 | XP_011536450.1 | |||
| XM_017019140.1 | 1511 | UTR 3 | XP_016874629.1 | |||
| XM_017019141.1 | 1511 | UTR 3 | XP_016874630.1 | |||
| XM_017019142.1 | 1511 | UTR 3 | XP_016874631.1 | |||
| LOC101927583 - uncharacterized LOC101927583 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SLC26A10 - solute carrier family 26 member 10 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_133489.2 | 1511 | Silent Mutation | CAA,CAG | Q,Q 400 | NP_597996.2 | |
Back To Top