Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_162087104_10
          See other ARHGEF25 GT Assays ›
          SNP ID:
          rs146080672
          Gene
          ARHGEF25 B4GALNT1 LOC101927583 SLC26A10
          Gene Name
          Rho guanine nucleotide exchange factor 25
          beta-1,4-N-acetyl-galactosaminyltransferase 1
          uncharacterized LOC101927583
          solute carrier family 26 member 10
          Set Membership:
          -
          Chromosome Location:
          Chr.12: 57624071 - 57624071 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TCTGCCAGATGCAGGAACTTCCACA[A/G]CTATGGCACATCAGCCGAGTGGACT

          Assay ID C_162087104_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 610215 MIM: 601873

          Literature Links:

          ARHGEF25 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          ARHGEF25 - Rho guanine nucleotide exchange factor 25
          There are no transcripts associated with this gene.
          B4GALNT1 - beta-1,4-N-acetyl-galactosaminyltransferase 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001276468.1 1511 Intron NP_001263397.1
          NM_001276469.1 1511 Intron NP_001263398.1
          NM_001478.4 1511 Intron NP_001469.1
          XM_005268773.4 1511 UTR 3 XP_005268830.1
          XM_011538147.2 1511 UTR 3 XP_011536449.1
          XM_011538148.2 1511 UTR 3 XP_011536450.1
          XM_017019140.1 1511 UTR 3 XP_016874629.1
          XM_017019141.1 1511 UTR 3 XP_016874630.1
          XM_017019142.1 1511 UTR 3 XP_016874631.1
          LOC101927583 - uncharacterized LOC101927583
          There are no transcripts associated with this gene.
          SLC26A10 - solute carrier family 26 member 10
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_133489.2 1511 Silent Mutation CAA,CAG Q,Q 400 NP_597996.2

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          ganglioside biosynthetic process
          carbohydrate metabolic process
          protein glycosylation
          glycosphingolipid metabolic process
          spermatogenesis
          lipid storage
          lipid glycosylation
          bicarbonate transport
          oxalate transport
          regulation of membrane potential
          regulation of intracellular pH
          sulfate transmembrane transport
          chloride transmembrane transport
          (N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity
          chloride channel activity
          secondary active sulfate transmembrane transporter activity
          bicarbonate transmembrane transporter activity
          sulfate transmembrane transporter activity
          anion:anion antiporter activity
          oxalate transmembrane transporter activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-zdkzh:80/100.66.76.145:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline