Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_162291446_10
          See other PXN GT Assays ›
          SNP ID:
          rs150356089
          Gene
          PXN PXN-AS1
          Gene Name
          paxillin
          PXN antisense RNA 1
          Set Membership:
          -
          Chromosome Location:
          Chr.12: 120212377 - 120212377 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          GCTTGTCGTTCTGCTCCTTGAAGGT[A/G]CCCTTGTTGAGCTGCTTGAGGCAGA

          Assay ID C_162291446_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602505

          Literature Links:

          PXN PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          A (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.00)
          (1.00)
          AMR
          A (0.00)
          (1.00)
          PXN - paxillin
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001080855.2 2536 Silent Mutation GGC,GGT G,G 571 NP_001074324.1
          NM_001243756.1 2536 Silent Mutation GGC,GGT G,G 585 NP_001230685.1
          NM_002859.3 2536 Silent Mutation GGC,GGT G,G 537 NP_002850.2
          NM_025157.4 2536 Silent Mutation GGC,GGT G,G 404 NP_079433.3
          XM_005253917.3 2536 Silent Mutation GGC,GGT G,G 383 XP_005253974.1
          XM_006719532.1 2536 Silent Mutation GGC,GGT G,G 1109 XP_006719595.1
          XM_006719534.1 2536 Silent Mutation GGC,GGT G,G 976 XP_006719597.1
          XM_006719535.3 2536 Silent Mutation GGC,GGT G,G 976 XP_006719598.1
          XM_006719536.2 2536 Silent Mutation GGC,GGT G,G 976 XP_006719599.1
          XM_011538622.1 2536 Silent Mutation GGC,GGT G,G 976 XP_011536924.1
          XM_011538623.1 2536 Silent Mutation GGC,GGT G,G 976 XP_011536925.1
          XM_017019726.1 2536 Silent Mutation GGC,GGT G,G 1115 XP_016875215.1
          XM_017019727.1 2536 Silent Mutation GGC,GGT G,G 1110 XP_016875216.1
          XM_017019728.1 2536 Silent Mutation GGC,GGT G,G 1107 XP_016875217.1
          XM_017019729.1 2536 Silent Mutation GGC,GGT G,G 1067 XP_016875218.1
          XM_017019730.1 2536 Intron XP_016875219.1
          XM_017019731.1 2536 Silent Mutation GGC,GGT G,G 976 XP_016875220.1
          XM_017019732.1 2536 Intron XP_016875221.1
          XM_017019733.1 2536 Silent Mutation GGC,GGT G,G 920 XP_016875222.1
          XM_017019734.1 2536 Silent Mutation GGC,GGT G,G 868 XP_016875223.1
          XM_017019735.1 2536 Silent Mutation GGC,GGT G,G 838 XP_016875224.1
          XM_017019736.1 2536 Silent Mutation GGC,GGT G,G 728 XP_016875225.1
          XM_017019737.1 2536 Silent Mutation GGC,GGT G,G 680 XP_016875226.1
          XM_017019738.1 2536 Silent Mutation GGC,GGT G,G 625 XP_016875227.1
          XM_017019739.1 2536 Silent Mutation GGC,GGT G,G 591 XP_016875228.1
          XM_017019740.1 2536 Silent Mutation GGC,GGT G,G 577 XP_016875229.1
          XM_017019741.1 2536 Silent Mutation GGC,GGT G,G 569 XP_016875230.1
          XM_017019742.1 2536 Silent Mutation GGC,GGT G,G 543 XP_016875231.1
          XM_017019743.1 2536 Silent Mutation GGC,GGT G,G 404 XP_016875232.1
          PXN-AS1 - PXN antisense RNA 1
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          actin or actin-binding cytoskeletal protein

          Gene Ontology Categories:

          Function(s) Process(es)

          muscle contraction
          cell adhesion
          cell-matrix adhesion
          signal transduction
          signal complex assembly
          epidermal growth factor receptor signaling pathway
          transforming growth factor beta receptor signaling pathway
          cellular response to reactive oxygen species
          vascular endothelial growth factor receptor signaling pathway
          growth hormone receptor signaling pathway
          integrin binding
          protein binding
          beta-catenin binding
          zinc ion binding
          vinculin binding
          protein kinase binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-tr4x4:80/100.66.75.98:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline