Search Thermo Fisher Scientific
- Order Status
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
CTGAACTGTCGCTGCAGCCTCCGAG[A/G]AGTGGGGAACCGTCTCTGGGCCCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603534 | ||||||||||||||||||||
Literature Links: |
AP1G2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AP1G2 - adaptor related protein complex 1 gamma 2 subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
JPH4 - junctophilin 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001146028.1 | 2511 | Silent Mutation | CTC,CTT | L,L 531 | NP_001139500.1 | |
NM_032452.2 | 2511 | Silent Mutation | CTC,CTT | L,L 531 | NP_115828.2 |
LOC102724814 - uncharacterized LOC102724814 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |